TECHNICAL REPORT

Blastocyst genotyping for quality control of mouse mutantarchives: an ethical and economical approach

Ferdinando Scavizzi . Edward Ryder . Stuart Newman . Marcello Raspa .

Diane Gleeson . Hannah Wardle-Jones . Lluis Montoliu . Almudena Fernandez .

Marie-Laure Dessain . Vanessa Larrigaldie . Zuzana Khorshidi . Reetta Vuolteenaho .

Raija Soininen . Philippe Andre . Sylvie Jacquot . Yi Hong .

Martin Hrabe de Angelis . Ramiro Ramirez-Solis . Brendan Doe

Received: 25 March 2015 / Accepted: 9 July 2015 / Published online: 16 July 2015

� The Author(s) 2015. This article is published with open access at Springerlink.com

Abstract With the advent of modern developmental

biology and molecular genetics, the scientific commu-

nity has generated thousands of newly genetically

altered strains of laboratory mice with the aim of

elucidating gene function. To this end, a large group of

Institutions which form the International Mouse Pheno-

typing Consortium is generating and phenotyping a

knockoutmouse strain for each of the*20,000 protein-

coding genes using the mutant ES cell resource

produced by the International Knockout Mouse Con-

sortium. These strains are made available to the

research community via public repositories, mostly as

cryopreserved sperm or embryos. To ensure the quality

of this frozen resource there is a requirement that for

each strain the frozen sperm/embryos are proven able to

produce viable mutant progeny, before the live animal

resource is removed from cages. Given the current

requirement to generate live pups to demonstrate their

mutant genotype, this quality control check necessitates

the use and generation of many animals and requires

considerable time, cage space, technical and economic

resources. Here, we describe a simple and efficient

method of genotyping pre-implantation stage blasto-

cysts with significant ethical and economic advantagesBrendan Doe, Ferdinando Scavizzi, Edward Ryder and Stuart

Newman have contributed equally to this work.

F. Scavizzi � M. Raspa

Consiglio Nazionale delle Ricerche (IBCN),

CNR-Campus International Development (EMMA-

INFRAFRONTIER- IMPC), A. Buzzati-Traverso

Campus, Via E. Ramarini 32, 00015 Monterotondo Scalo,

Roma, Italy

E. Ryder � S. Newman � D. Gleeson � H. Wardle-Jones �R. Ramirez-Solis � B. Doe (&)

Wellcome Trust Sanger Institute, Hinxton,

Cambridgeshire CB10 1SA, UK

e-mail: bd2@sanger.ac.uk

L. Montoliu � A. FernandezDepartment of Molecular and Cellular Biology, National

Centre for Biotechnology (CNB-CSIC), Campus de

Cantoblanco, Darwin 3, 28049 Madrid, Spain

L. Montoliu � A. FernandezCIBERER, ISCIII, Madrid, Spain

M.-L. Dessain � V. LarrigaldieCNRS, TAAM-CDTA UPS44, 3B rue de la Ferollerie,

CS 20057 45071 Orleans Cedex 2, France

Z. Khorshidi

Karolinska Center for Transgene Technologies,

Comparative Medicine, Karolinska Institutet, von Eulers

vag 4a, 171 77 Stockholm, Sweden

R. Vuolteenaho � R. SoininenBiocenter Oulu, University of Oulu, Aapistie 5 A,

90220 Oulu, Finland

P. Andre � S. JacquotICS France Institut Clinique de la Souris, PHENOMIN,

ICS-MCI, CNRS, INSERM, Universite de Strasbourg,

1 rue Laurent Fries, 67404 Illkirch, France

123

Transgenic Res (2015) 24:921–927

DOI 10.1007/s11248-015-9897-1

especially beneficial for current and future large-scale

mouse mutagenesis projects.

Keywords Cryopreservation � Mouse � PCR �Quality control (QC) � 3R’s � Network of repositories

Introduction

The International Mouse Phenotyping Consortium

(IMPC) (Ayadi et al. 2012; Brown and Moore 2012a,

b; Laughlin et al. 2012; Ramırez-Solis et al. 2012;

White et al. 2013) is a large scale international

consortium whose aim is to generate and primary

phenotype a knockout mouse strain for each of the

*20,000 protein-coding genes using the mutant ES

cell resource produced by the International Knockout

Mouse Consortium (IKMC) (Bradley et al. 2012;

Skarnes et al. 2011). Cryopreservation strategies have

been adopted for long-term storage of these and other

research animal resources (Glenister et al. 1990). This

facilitates their availability to the worldwide scientific

community and provides resilience to potential catas-

trophic loss of a strain. To this end, several large

centralised repositories have been established around

the world, including the Infrafrontier/European

Mutant Mouse Archive (EMMA) (INFRAFRONTIER

Consortium 2014; Wilkinson et al. 2010), the Knock-

Out Mouse Project Repository (KOMP) (Lloyd 2011),

the Jackson Laboratory Repository (Jax) (Ostermeier

et al. 2008), The Center for Animal Resources and

Development (CARD) (Nakagata and Yamamura

2009) and the Riken Bio Resource Center (Yoshiki

et al. 2009), which provide cryopreserved material or

live mice to receiving laboratories.

Ensuring a high level of quality control and

validation of cryopreserved mouse germplasm is

imperative. This is a long and expensive process that

has to be performed for every batch of frozen material.

Repositories of mutant strains therefore invest a

significant amount of cost, time and resources to

assess and secure the quality and vitality of cryopre-

served sperm and embryo banks. This process also

requires that many animals are bred and sacrificed to

validate the freezing process and perform QC.

A typical validation will involve thawing cryopre-

served sperm to ensure fertilisation post-thaw can be

achieved at a predetermined level ([10 % of treated

eggs at EMMA) and can produce viable embryos. This

requires an in vitro fertilisation (IVF) procedure

followed by surgical embryo transfer to pseudopreg-

nant recipient females, pregnancy with births, and

confirmation of the expected mutant genotypes from

the resultant litter usually from tissue derived from an

ear clip. Often, the genotyped mice have no additional

use. The strain is considered secure when the quality

control (validation process) is concluded.

Many animals need to be produced to support the

development of the embryos to term, i.e. enough

oestrus foster mice to be mated with vasectomised

males to have suitable (vaginally-plugged) animals for

the surgical embryo transfer. Typically, 2–3 transfers

are performed per strain to be validated. Surgery must

also be performed to generate the vasectomised males.

Additionally, there can be a high repeat rate of the QC

process if failed pregnancy and/or low birth rates result

in a lack of sufficient pups from which to confirm the

genotype.

We have successfully investigated a new simple

and efficient methodology that involves the viability

testing and genotyping directly on individual preim-

plantation blastocyst-stage embryos generated from

fresh IVF or from frozen/thawed 2-cell stage embryos

originally produced by IVF. This new approach has

major ethical advantages by reducing greatly the

number of animals used in the QC process. It also

ensures that QC is processed faster, more robustly, and

with significant reductions in cage space, technical

resources, and overall cost.

Materials and methods

In vitro fertilisation (IVF) and embryo culture

For each batch of cryopreserved sperm, preimplanta-

tion embryos were generated by thawing a sample of

the cryopreserved sperm and fertilising in vitro super-

ovulated wildtype oocytes from the same genetic

background (usually C57BL/6) as previously

described (Behringer et al. 2014). To demonstrate the

survival and fertilisation ability of the sperm post-thaw

Y. Hong � M. H. de Angelis

Institute of Experimental Genetics, Helmholtz Zentrum

Munchen—German Research Center for Environmental

Health (GmbH), Neuherberg, Germany

922 Transgenic Res (2015) 24:921–927

123

and to estimate the viability of the resource, the embryos

were allowed to develop to the blastocyst stage in vitro or

cryopreserved at the 2-cell stage and then thawed and

cultured in KSOM media at a later date for 3–4 days to

develop into blastocyst. For each strain, approximately

15 2-cell embryos were used to produce blastocysts. The

probability of detecting a heterozygote is 99.99 % if

analysing 15 embryos from a heterozygoye 9 wildtype

cross.

Blastocyst genotyping

The blastocysts are pooled into a 500 ll drop of M2 in

a Petri dish. From here a single blastocyst is aspirated

in a pulled Pasteur pipette in a minimal volume of M2

and placed directly into the bottom of a 0.2 ml PCR

tube or in a well of a 96-well plate. This plate can be

stored frozen at -20 �C.

Blastocyst genotyping conditions

DNA lysis 10 ll of lysis buffer PBND containing

0.1 mg/ml Proteinase K is added directly to each well

containing a blastocyst and the plate placed in a

Thermomixer with agitation at 56 �C for 30 min rising

to 95 �C to for 10 min to inactivate the Proteinase K.

Samples are vortexed (10–15 s) and allowed to cool

briefly then centrifuged for 1 min.

PBND (PCR Buffer Nonionic Detergents)

50 mM KCl

10 mM Tris–HCl (PH 8.3)

2.5 mM MgCl20.1 mg/ml gelatin

0.45 % v/v Nonidet P40 (NP40)

0.45 % v/v Tween 20

Proteinase K SIGMA-ALDRICH

G1N350 100 mg in 5.05 ml H2O

PCR amplification Reaction conditions are shown

below a PCR with specific primers and/or internal

control primers, using 1.5 units of AmpliTaq Gold

(other polymerases have also been successfully used

including Invitrogen platinum Taq, Roche Taq

polymerase, SuperTherm Taq polymerase and Phire

Green Hot Start II DNA Polymerase).

Cycling conditions will vary depending on the

annealing temperature of the primers and the gene to

be amplified, and can vary between 35 and 60 cycles.

PCR MIX with specific primers:

PCR MIX with specific and internal control

primers:

*Selection of genes and primers that can be used as

internal controls

Interleukin 6 (IL-6) Amplified product 170 bp

IL-6 For 50-TTC CAT CCA GTT GCC TTC TTG

G-30

IL-6 Rev 50-TTC TCA TTT CCA CGA TTT CCC

AG-30

Kelch-like protein 18 (Klhl18) 524 bp

Klhl18_42066_For 50 CCTGTGACAAGCAGTCTGAAGG

Klhl18_42066_Rev 50 TGCTAGGGAGTGAATCT

AGGGC

Immunoglobulin heavy chain-joining region (Igh-j)

290 bp

Igh-j For 50 TGT-CCA-GGG-TCT-ATC-GGA-CTIgh-j Rev 50 GTT-TTT-CCT-CTG-TAC-CCG-AC

dNTPS (2 mM) 3 ll

PCR BUFFER 109 3 ll

PRIMER 1 (0.5 lM/ll)

PRIMER 2 (0.5 lM/ll)

PRIMER 3 (0.5 lM/ll)

H2O

TAQ POLYMERASE (5 U/ll) 0.3 ll

DNA (5 ll of lysate) 5 ll

TOTAL 30 ll

dNTPS (2 mM) 3 ll

PCR BUFFER 109 3 ll

PRIMER 1 (0.5 lM/ll)

PRIMER 2 (0.5 lM/ll)

PRIMER IL-6 For (0.1 lM/ll)

PRIMER IL-6 Rev (0.1 lM/ll)

H2O

TAQ POLYMERASE (5 U/ll) 0.3 ll

DNA (5 ll of lysate) 5 ll

TOTAL 30 ll

Transgenic Res (2015) 24:921–927 923

123

Bradykinin receptor, beta 1 (B1 receptor gene)

340 bp

B1 For 50 CTC-AGG-GAG-GCC-AGG-ATG-TGB1 Rev 50 TCA-GCG-GGG-TCA-TCA-AGG-CC

Ventral anterior homeobox gene (Vax 1) 400 bp

VAX1For 50 CGT-AAT-CAA-TTG-CAA-CAG-CGA-GVAX1Rev50 AGA-AGG-AGG-GTG-GGA-AAA-GAA-G

Gremlin 1 gene (Grem 1) 500 bp

Grem1For 50 ATG-AAT-CGC-ACC-GCA-TAC-ACT-GGrem1Rev 50TCC-AAG-TCG-ATG-GAT-ATG-CAA-CG

Retinoblastoma gene (Rb1) 650 bp

Rb1 For 50 GGC-GTG-TGC-CAT-CAA-TGRb1 Rev 50 AAC-TCA-AGG-GAG-ACC-TG

Pyruvate kinase, muscle Pkm 529 bp

Pkm For 50 TTTGAGTAGCACCCACATAACCAPkm Rev 50 CATGAAAAAGACCACCCCTGAACROSA 420 bp

Rosa For 50-ACT GGG ATC TTC GAA CTC TTT

GGA C

RosaRev 50-GATGTTGGGGCACTGCTCATTCACC

*(Bonaparte et al. 2013)

DNTPS (Deoxynucleoside Triphosphate Set PCR

Grade) 4 9 25 lmol (250 ll) RochePCR Buffer 103 & 15 mM MgCl2 Applied

Biosystems

AmpliTaq Gold DNA 250 Units, 5 U/ll Applied

Biosystems

Strains do not fail QC due to pregnancy/birth

failure

Analysis of collective repository QC data of frozen/

thawed sperm obtained over a period of 4 years where

IVF derived embryos were transferred to recipient

females, showed that no frozen strains have failed the

QC process due to the inability of preimplantation

embryos produced by IVF to implant and develop to

term, or because of a failure of the newborn pups to

thrive. Table 1 shows that of a total of 918 strains

cryopreserved, thawed and transferred to recipient

females for QC, 30 failed to pass the frozen/thawed

sperm QC. Of these 30, the largest proportion of

failures (26) was due to fertilisation rates (i.e. devel-

opment from zygote to 2-cell stage embryo) below an

arbitrary 10 % rate of the number of oocytes used

during the IVF. This does not necessarily mean that a

strain could not be recovered, only that the operational

threshold defined by the standard operation procedure

(SOP) was not met. In fact, of these 26, 8 strains

resulted in recovering live pups. The other four failed

strains were due to a genotype mismatch caused by the

use of the incorrect mice during the freezing. This data

suggested that demonstration of IVF-derived embryos

developing past the 2-cell to the blastocyst stage and

which were correctly genotyped could be sufficient to

provide a robust QC assessment without the need to

transfer the embryos to recipient females.

Blastocysts can be genotyped in a robust manner

We used PCR reactions to generate the genotypes from

blastocyst stage embryos. Figure 1a, shows a strain

example of gel electrophoresis of the PCR products

demonstrating the genotypes obtained from blastocysts.

Table 2 summarizes the experience across the multiple

members of the Infrafrontier consortium. A total of 289

strains have undergone quality control by blastocyst

PCR genotyping of which 283 (98 %) have passed QC.

In terms of individual blastocysts, a total of 4450 have

been analysed and 4053 (91 %) have successfully

amplified DNA to demonstrate the genotype. A very

few strains have failed to be successfully genotyped by

Table 1 Showing the number of freeze attempts and the rea-

son of failures in the QC process post thaw and IVF using

IKMC derived EUCOMM/KOMP USD alleles on a C57Bl6/

NTac genetic background

Strains Number

Cryopreserved 918

QC-failed 30

Low fertilisation rate failures (\10 %) 26

Incorrect genotype failures 4

To date data from The Wellcome Trust Sanger Institute

(WTSI) and The European Mouse Mutant Archive (EMMA)

partners, show that failure to recover a line due to an inability

to produce live offspring following thawing of cryopreserved

sperm and IVF has never occurred

924 Transgenic Res (2015) 24:921–927

123

blastocyst genotyping (2 %). These appear to be

technical failures of the PCR possibly due to primer

design or secondary structure making the region

difficult to amplify, or where one assay works but

another fails making the final genotype call ambiguous.

Discussion

We tested a much improved quality control method to

determine the ability to recover a mutant mouse strain

which has been stored in a cryopreserved form. Two

conditions need to be met to apply this methodology a)

a large proportion of fertilised embryos developed

from IVF in vitro should survive to produce blasto-

cysts and b) a reliable method to genotype blastocysts

must be available.

Instead of transferring IVF generated 2-cell stage

embryos into recipient females to allow development

to term and genotyping the resultant pups, our

approach relies in vitro culture of the IVF-derived

embryos to the blastocyst stage and genotyping of

these embryos. Only 15 embryos per strain are

required to perform the blastocyst genotyping QC

with a 99.99 % probability, as compared to the 40–60

embryos (i.e. 2–3 embryo transfers) necessary when

using the current QC protocol for pup generation. An

additional advantage is that more fertilization events

(i.e. embryos) can be genotyped because losses due to

lost pregnancies (*20 %) or other development

issues which normally reduce the number of surviving

pups to 30 % are avoided.

The blastocyst genotyping approach is flexible and

can be used for all kinds of mutations including those

Fig. 1 Blastocyst PCR reaction for Lrrc71tm1a(KOMP)Wtsi using

three primers in multiplex to amplify the WT (515 bp) and

mutant (258 bp) alleles in the same reaction. Samples are

visualised on a QIAxcel Advanced System (Qiagen). Genotype

calls are shown above each sample lane and the last three lanes

contain negative controls

Table 2 Overall and cross

centre results using

blastocyst genotyping

Centre Strains Blastocysts

QC’ed Pass Success rate QC’ed Pass Success rate

CNB3,4 17 17 100 325 325 100

CNR1 62 61 98 1104 1070 97

CNRS5 21 20 95 240 203 84

HMGU9 14 14 100 406 386 95

ICS8 61 60 98 718 639 89

KI6 12 12 100 97 96 99

Oulu7 18 16 89 235 209 89

WTSI2 84 83 99 1325 1125 85

Totals 289 283 98 4450 4053 91

Transgenic Res (2015) 24:921–927 925

123

generated by recent genome editing techniques such as

Crispr/Cas9 that can be discriminated by one or a

limited number of PCR reactions (the DNA extracted

from a blastocyst is sufficient for 2–3 PCR reactions).

The method can be applied to any large or small scale

repositories that maintain sperm or embryos as frozen

stocks. Given the size of the blastocyst, caution needs

to be exercised in the embryo manipulations prior to

lysis to avoid sample loss.

This shortens the QC process by approximately

2 months and saves a significant amount of resources

whilst providing a clear ethical improvement compat-

ible with 3R’s (Reduction, Refinement, Replacement)

principle championed by Russel and Burch (1959)

since it reduces the number of animals bred, subjected

to surgery and sacrificed for genotyping. We have

calculated that we would save on average 14 animals

per strain across all contributing centres if using

blastocyst genotyping to confirm the QC of the

cryopreservation process when compared to conven-

tional methods. Animals would be saved at various

points in the QC process including recipient foster

mothers (2), vasectomised males (1), pups born to be

genotyped (8), and females used as oocyte donors (3).

For a large-scale project like IMPC, an estimated 5000

strains will have been deposited by the end of 2016

(Phase 1) (Brown andMoore 2012b) Using blastocysts

to verify the QC process for cryopreserving this

number of lines would save an estimated 70,000

animals over current methods of genotyping pups.

We also calculated how many cage-weeks using

this methodology would save. On average we save 14

cage-weeks per line using traditional genotyping

methods (Recipient cages pre and post embryo

transfer, breeding cages for stocks, female donor

cages for superovulation, and cages to house vasec-

tomised males). Therefore across the life of the project

calculating 5000 strains generated for the IMPC in

phase 1 of the project this would save 70,000 cage

weeks across a 5 year period.

Other potential uses of blastocyst genotyping

surround new genome editing technologies such as

Crispr/Cas9 (Wang et al. 2013). Culturing of embryos

to blastocyst of a few experimentally injected embryos

will allow a first look to determine the efficiency of the

gRNA’s and Crispr materials in generating your

desired mutation. Blastocyst genotyping may also be

used as a first experimental step with Crispr/Cas9 in

evaluation and optimisation of experimental design in

generating mutants with more complex alleles for

which efficiencies currently remain low with this

technology, such as large insertions in homologous

recombination.

In summary, using blastocyst genotyping instead of

conventional methods leads to significant reductions

in animal welfare concerns, processing time, technical

requirements, and cost. Therefore, we would like to

propose the blastocyst genotyping method as the

preferred protocol for QC purposes to validate the

correct cryopreservation of mouse strains in world-

wide large mouse embryo and sperm banks.

Acknowledgments We would like to thank the following

people for invaluable help and excellent technical support with

this work; The Mouse production team, James Bussell and the

Research Support Facility, Joanna Bottomley, the SangerMouse

Genetics Project (MGP),Sebastian Gerety and Katharina

Boroviak (Wellcome Trust Sanger Institute, UK) Julia

Fernandez, Maria Jesus del Hierro, Marta Castrillo and Isabel

Martin-Dorado (CNB-CSIC, Spain) Matteo Parmigiani and

Fabrizio Buonaventura (CNR- Italy) Susan Marschall, Stefanie

Dunst, Markus Romberger and Alexander Wolf (HMGU-

Germany) and Belner Amelie, Seghrouchni Emmanuelle and

Chaumes Cyrielle (TAAM-CDTA—Orleans). This work was

supported by The Wellcome Trust under Grant Number

WT098051 and The European Commission Infrafrontier—I3

EC FP7 Capacities Specific Programme Grant Number 312325.

Compliance with ethical standards

Ethical standard All applicable European, national, and

institutional guidelines for the care and use of animals were

followed. All procedures performed in studies involving ani-

mals were in accordance with the ethical standards of the

institution or practice at which the studies were conducted.

Open Access This article is distributed under the terms of the

Creative Commons Attribution 4.0 International License (http://

creativecommons.org/licenses/by/4.0/), which permits unrest-

ricted use, distribution, and reproduction in any medium, pro-

vided you give appropriate credit to the original author(s) and

the source, provide a link to the Creative Commons license, and

indicate if changes were made.

References

Ayadi A, Birling M-C, Bottomley J, Bussell J, Fuchs H, Fray M

et al (2012) Mouse large-scale phenotyping initiatives:

overview of the European Mouse Disease Clinic

(EUMODIC) and of the Wellcome Trust Sanger Institute

Mouse Genetics Project. Mamm Genome. doi:10.1007/

s00335-012-9418-y

Behringer R, Gertsenstein M, Nagy KV, Nagy A (2014)

Manipulating the mouse embryo: a laboratory manual, 4th

926 Transgenic Res (2015) 24:921–927

123

edn. Retrieved 6 Jan 2015, from http://cshlpress.com/

default.tpl?cart=142056164145306854&action=full&–

eqskudatarq=982

Bonaparte D, Cinelli P, Douni E, Herault Y, Maas M, Pakarinen

P et al (2013) FELASA guidelines for the refinement of

methods for genotyping genetically-modified rodents: a

report of the Federation of European Laboratory Animal

ScienceAssociationsWorkingGroup. LabAnim 47(March):

134–145. doi:10.1177/0023677212473918

Bradley A, Anastassiadis K, Ayadi A, Battey JF, Bell C, Birling

M-C et al (2012) The mammalian gene function resource:

the International Knockout Mouse Consortium. Mamm

Genome 23(9–10):580–586. doi:10.1007/s00335-012-

9422-2

Brown SDM, Moore MW (2012a) The International Mouse

Phenotyping Consortium: past and future perspectives

on mouse phenotyping. Mamm Genome. doi:10.1007/

s00335-012-9427-x

Brown SDM,Moore MW (2012b) Towards an encyclopaedia of

mammalian gene function: the International Mouse

Phenotyping Consortium. Dis Models Mech 5(3):289–292.

doi:10.1242/dmm.009878

Glenister PH, Whittingham DG, Wood MJ (1990) Genome

cryopreservation: a valuable contribution to mammalian

genetic research. Genet Res 56(2–3):253–258

INFRAFRONTIER Consortium (2014) INFRAFRONTIER-

providing mutant mouse resources as research tools for the

international scientific community. Nucleic Acids Res.

doi:10.1093/nar/gku1193

LaughlinMR,LloydKCK,ClineGW,WassermanDH(2012)NIH

Mouse Metabolic Phenotyping Centers: the power of cen-

tralized phenotyping. Mamm Genome 23(9–10):623–631.

doi:10.1007/s00335-012-9425-z

Lloyd KCK (2011) A knockout mouse resource for the

biomedical research community. Ann N Y Acad Sci

1245:24–26. doi:10.1111/j.1749-6632.2011.06311.x

Nakagata N, Yamamura K-I (2009) Current activities of CARD

as an international core center for mouse resources. Exp

Anim/Jpn Assoc Lab Anim Sci 58(4):343–350

Ostermeier GC, Wiles MV, Farley JS, Taft RA (2008) Con-

serving, distributing and managing genetically modified

mouse lines by sperm cryopreservation. PLoS ONE

3(7):e2792. doi:10.1371/journal.pone.0002792

Ramırez-Solis R, Ryder E, Houghton R, White JK, Bottomley J

(2012) Large-scale mouse knockouts and phenotypes.

Wiley Interdiscip Rev Syst Biol Med 4(6):547–563

Russel W, Burch R (1959) The principles of humane experi-

mental technique. Metheun and Co., Ltd, London

Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W,

Iyer V et al (2011) A conditional knockout resource for the

genome-wide study of mouse gene function. Nature

474(7351):337–342. doi:10.1038/nature10163

Wang H, Yang H, Shivalila CS, Dawlaty MM, Cheng AW,

Zhang F, Jaenisch R (2013) One-step generation of mice

carrying mutations in multiple genes by CRISPR/Cas-

mediated genome engineering. Cell 153(4):910–918.

doi:10.1016/j.cell.2013.04.025

White JK, Gerdin A-K, Karp NA, Ryder E, Buljan M, Bussell

JN et al (2013) Genome-wide generation and systematic

phenotyping of knockout mice reveals new roles for many

genes. Cell 154(2):452–464. doi:10.1016/j.cell.2013.06.

022

Wilkinson P, Sengerova J, Matteoni R, Chen C-K, Soulat G,

Ureta-Vidal A et al (2010) EMMA–mouse mutant

resources for the international scientific community.

Nucleic Acids Res 38(Database issue):D570–D576.

doi:10.1093/nar/gkp799

Yoshiki A, Ike F, Mekada K, Kitaura Y, Nakata H, Hiraiwa N

et al (2009) The mouse resources at the RIKEN BioRe-

source center. Exp Anim Jpn Assoc Lab Anim Sci

58(2):85–96

Transgenic Res (2015) 24:921–927 927

123