Isothiocyanate–drug interactions in the human adenocarcinomacell line Caco-2

Katarzyna Lubelska • Irena Misiewicz-Krzeminska • Małgorzata Milczarek •

Jolanta Krzyszton-Russjan • El _zbieta Anuszewska • Karolina Modzelewska •

Katarzyna Wiktorska

Received: 23 November 2011 / Accepted: 3 April 2012 / Published online: 18 April 2012

� Springer Science+Business Media, LLC. 2012

Abstract Isothiocyanates, among which alyssin is coun-

ted, are the compounds that have proved chemopreventive

properties and the ability to induce the 2 and the 3 detox-

ification phase by affecting the transcription factor nuclear

erythroid 2-related factor (Nrf2). Having a positive effect

on the human body, these compounds are used as dietary

supplements. Because of the observed increase in the

consumption of dietary supplements taken along with the

drugs routinely used in medical practice, this study

examined the possibility of interactions between alyssin

and drugs, which could have an impact on cell metabolism.

We have determined the effects of the tested substances

and their interactions on the expression and activity of the

phase 2 genes, as well as on the drug transport, which could

be influenced by affecting the expression of transport

proteins that belong to the 3 phase of metabolism. It was

also studied whether the transcription factor Nrf2 is

responsible for the interactions that occurred. The results

showed that the interactions between alyssin and the tested

drugs strengthen or weaken the effect of the drugs given

separately depending on the concentration of alyssin and

the type of drug. Even though Nrf2 is involved in the

interaction, it seems that it is not the only factor regulating

the interactions between the tested medications.

Keywords Isothiocyanate � Nrf2 � Drug interactions �Multidrug resistance � Caco-2

Abbreviations

ITC Isothiocyanate

Nrf2 Nuclear erythroid 2-related factor

Keap1 protein Kelch-like ECH-associated protein 1

ARE Antioxidant response element

GSTM1 Glutathione S-transferase Mu 1

GSTA3 Glutathione S-transferase A3

QR NAD(P)H dehydrogenase [quinone] 1

MRP1 Multidrug resistance-associated protein 1

PGP P-glycoprotein

MDR Multidrug resistance

Introduction

A dietary supplement is defined as a food component

responsible for an effect that is beneficial for the human

health. However, this effect may be disturbed or changed

when taken dietary supplements interact with the drugs

commonly used in medical practice [1, 2].

In spite of very little data on pharmacological effects of

dietary supplements [3], some of their interactions with

drugs have already been described, among other things, the

interaction between aspirin—a non-steroidal anti-inflam-

matory drug (NSAID) and the preparations containing

bilberry, garlic, ginseng [4], as well as the interactions

between the components of grapefruit juice and drugs, for

instance, felodipine [5] and verapamil [6].

Isothiocyanates (ITCs) is a group of compounds found

in plants that belong to the Cruciferae family. Owing to

their properties favorable to health, ITCs are already

available on the market as dietary supplements. Numer-

ous literature data indicate chemopreventive properties of

ITCs, which reduce the risk of developing cancers [7].

Chemopreventive action of ITCs manifests, among other

K. Lubelska � I. Misiewicz-Krzeminska � M. Milczarek �J. Krzyszton-Russjan � E. Anuszewska � K. Modzelewska �K. Wiktorska (&)

National Medicines Institute, Chelmska 30/34,

00-725 Warsaw, Poland

e-mail: wiktorska@il.waw.pl

123

Mol Cell Biochem (2012) 367:19–29

DOI 10.1007/s11010-012-1314-y

things, by inducing phase 2 metabolic enzymes, such as

quinone reductase (QR) or GST-glutathione transferases

(e.g., GSTM1 and GSTA3). These enzymes are respon-

sible for detoxification and elimination of xenobiotics

and their metabolites. The main role in inducing phase 2

enzymes is played by the transcription factor nuclear

erythroid 2-related factor (Nrf2). Under physiological

conditions, Nrf2 is bound in the cytoplasm to the

Keap1 protein (Kelch-like ECH-associated protein 1).

The exposure to endogenous or exogenous factors (e.g.,

ITCs) leads to the rupture of the Nrf2–Keap1 bond and

as a result Nrf2 is translocated from the cytoplasm into

the cell nucleus. As a consequence of Nrf2 translocation,

this transcription factor binds to the antioxidant response

element (ARE) located in the promoter regions of the

genes encoding phase 2 metabolic enzymes, which in

turn leads to the expression of these genes [8]. Also,

drugs and other substances, the assumed purpose of

activity of which is different, can influence Nrf2, activate

the 2 phase of metabolism, and in this way affect oxi-

dation state of cells, metabolism, or the action of other

drugs [9, 10].

The phase 3 metabolic enzymes include transport pro-

teins MRP1 (multidrug resistance-associated protein (1)

and PGP (P-glycoprotein). They belong to the superfamily

of ABC proteins (ATP-binding cassette) and function as

membrane transporters that play a key role in the transport

of various drugs, including cytostatics, and reduce the

effectiveness of chemotherapy by contributing to multidrug

resistance (MDR) [11]. According to recent studies, the 2

and the 3 phase of metabolism are not only linked by their

activity (membrane transporters are responsible for elimi-

nating products of phase 2 enzymes [12]) but also regulated

together. As far as the action is concerned, membrane

transporters also interact with GSTs in detoxification of

cells by transporting conjugates of glutathione (GSH) with

electrophilic substances of various kinds, including car-

cinogens, as well as transporting the products of the first

and the 2 phase of metabolism and antineoplastic drugs

[13, 14].

This work studied the interaction of isothiocyanate that

naturally occurs in the species of Alyssum, Cruciferae

family, alyssin (isothiocyanate, 5-methylsulfinyl-n-amyl-

CH3SO–(CH2)5–NCS) with the drugs that belong to dif-

ferent groups according to the Biopharmaceutical Classi-

fication System: verapamil, that is used to treat

hypertension and arrhythmia, ketoprofen, which is used in

rheumatoid arthritis and furosemide—used to treat pul-

monary and brain edema, hypercalcaemia, and poisonings.

Alyssin is considered the most promising sulforaphane

analog with respect to chemopreventive properties [15] and

has already been shown among other things to reveal

chemopreventive action by inducing QR in healthy human

lymphoblastoids [16].

It was studied whether the interactions between alyssin

and the above mentioned drugs change metabolic activity

of cells, which is manifested as (i) a change in the drug

detoxification system examined by testing the induction of

expression of phase 2 marker enzyme: QR, and studying

gene expression of phase 2 metabolic enzymes: GSTM1

and GSTA3; and (ii) a change in the transport of drugs

manifested by the alternation in the induction of genes that

encode phase 3 metabolic enzymes: PGP and MRP1. At the

same time, it was determined whether the observed chan-

ges in cell metabolism result from the changed location of

the transcription factor Nrf2 as a consequence of interac-

tions between alyssin and drugs.

The study was conducted on human colon Caco-2 cells

to evaluate interactions between alyssin and orally

administrated substances in the gastrointestinal tract. These

interactions may lead to alterations in drug bioavailability

and can also contribute to multidrug resistance. These cells

have already been applied to research using ITCs or drugs

[17–19], and also for the investigation of interactions

between drugs and other natural dietary ingredients in the

gastrointestinal tract [20].

Materials and methods

Chemicals

Verapamil, ketoprofen, and furosemide were purchased

from Sigma-Aldrich (Co, St. Louis, MO, USA). Alyssin

(methylsulfinyl-n-amyl isothiocyanate) was synthesized as

described previously by Schmidt and Karrer [21] and its

purity was 99.8 %, as determined by gas chromatography

at the Department of Chemistry, University of Warsaw.

The solution of verapamil was prepared in methanol,

furosemide in acetone, and ketoprofen and alyssin

in DMSO. Primers were synthesized and purified by HPLC

in the company Genomed (Warsaw, Poland). MTT, sol-

vents and buffer components for testing QR activity,

Bradford reagent, materials for cell culture, and antibodies

were purchased from Sigma-Aldrich (Co, St. Louis, MO,

USA). An RNeasy Plus Micro Kit, and RNAprotect� Cell

Reagent were purchased from the company Qiagen

(GmbH, Hilden, Germany), RevertAidTM

H Minus First

Strand cDNA Synthesis Kits, DNase I, RNase—free were

purchased from the company Fermentas (St. Leon-Rot,

Germany), qPCR 5 9 HOT FIREPol� EvaGreen� qPCR

Mix Plus (ROX) were purchased from the company Solis

Biodyne (Riia, Estonia). FlashGel� Dock was purchased

from the company Lonza (Rockland, ME, USA).

20 Mol Cell Biochem (2012) 367:19–29

123

Cells

The human adenocarcinoma cell line Caco-2, from the

American Type Culture Collection (ATCC), was cultured

in the supplemented medium Minimum Essential Medium

Eagle (MEM), supplemented with 20 % heat-inactivated

fetal bovine serum, penicillin (100 UI/ml, streptomycin

(100 lg/ml), amphotericin (250 ng/ml), L-glutamine

(2 mM), and non-essential amino acids. Cells were grown

at 37 �C in a humidified atmosphere containing 5 % CO2.

The medium was changed every 48 h, and after reaching

80 % confluence cells were subcultured with 0.25 %

trypsin. For all experiments, the cells were seeded at

a density of 6.5 9 104 cells/ml. All experiments included

three independent tests.

MTT test

The test is based on measuring the amount of formazan

produced owing to the ability of mitochondrial dehy-

drogenase, a part of the respiratory chain, to reduce a

water-soluble 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-

tetrazolium bromide (MTT). Damaged or dead cells

have low or zero dehydrogenase activity. This test can

therefore determine cell viability (mitochondrial activity

thereof) [17]. To test cytotoxicity of the compounds, the

Caco-2 cells were incubated with alyssin solutions at

concentrations of 2.5 lM, 5 lM, 10 lM, 20 lM, and

40 lM and with verapamil, ketoprofen, or furosemide at

concentrations of 0.25 mM. The cells were incubated for

3 h with alyssin and the drugs or for 48 h with alyssin

and then for 3 h with the drugs. After washing with

PBS, the cells were incubated for 3 h with MTT solu-

tion and the formed crystals were dissolved with iso-

propyl alcohol. The absorbance of formazan was

measured in a Power Wavex microplate spectropho-

tometer (Biotek Instruments) at a wavelength of 570 nm

and 690 nm [22]. Based on MTT data and by Sigma

Plot software IC50 values were determined, that is

concentrations causing death of 50 % of the cells in

culture (Table 1).

A determination of QR activity

This method uses the ability of QR to reduce vitamin K

(menadione). Menadiol, a product of menadione reduction,

spontaneously reduces MTT to formazan. The absorbance

of formazan is a measured quantity, which is directly

proportional to QR activity. QR activity was compared to

the amount of protein in the cells. The measurement of

protein was taken by the Bradford method [23]. During

simultative incubation, the Caco-2 cells were incubated at

the same time with alyssin at a concentration of 5 lM and

with the drugs at concentrations of 0.25 mM. During

sequential incubation, the cells were incubated for 32 h

with 2.5 and 10 lM alyssin and then for 3 h with the drugs

at a concentration of 0.25 mM. To determine QR the cells

were lysed and incubated for 10 min with a buffer. The

absorbance of formazan was measured in a Power Wavex

microplate spectrophotometer (Biotek Instruments) at a

wavelength of 610 nm [24]. The experiment included three

independent tests.

Immunofluorescence determination of Nrf2 location

A determination of the location of the factor Nrf2 was

carried out by the immunocytochemistry method. The

Caco-2 cells were incubated for 1 h with the drugs at a

concentration of 0.25 mM and supplemented with alyssin

at concentrations of 2.5 and 10 lM. Next, the cells were

fixed with 4 % paraformaldehyde/PBS and permeabilized

with 0.1 % TritonX-100/PBS. After determining optimal

antibody dilutions, the cells were subjected to sequential

incubation with a mouse primary anti-Nrf2 antibody (1:50)

and an anti-mouse secondary antibody, FITC labeled

(1:100). The preparations were analyzed using a confocal

microscope (Olympus I 9 70 Fluoview500) equipped with

409 objective lens using a blue laser light source with a

wavelength of 488 nm.

A determination of GSTA3, GSTM1, PGP, and MRP1

gene expression

To test gene expression, the Caco-2 cells were incubated

for 24 h with alyssin solutions at concentrations of 2.5 and

10 lM and for 3 h with the drugs at a concentration of

0.25 mM. Next, gene expression was determined by the

qPCR method (Real-Time quantitative PCR).

RNA isolation

To stabilize RNA, the cells were suspended in the RNA-

protect� Cell Reagent. The isolation of total RNA was

performed using the RNeasy Plus Micro Kit in accordance

with the manufacturer’s instructions. The quality of RNA

Table 1 IC50 values of Caco-2 cells after 48 h subsequent incubation

with 2.5–40 lM alyssin and 3 h with 0.25 mM of drugs: verapamil,

ketoprofen, and furosemide

Compound IC50 (lM)

Alyssin 24.4 ± 1.4

Alyssin i Verapamil 21.9 ± 2.1

Alyssin i Ketoprofen 26.1 ± 7.1

Alyssin i Furosemide 29.2 ± 5.4

Mol Cell Biochem (2012) 367:19–29 21

123

was examined by determining an integrity coefficient using

the FlashGel system and the cassettes for RNA electro-

phoresis containing 1.2 % agarose. RNA samples with the

integrity of (2:1) were qualified for further tests. The

concentration of RNA samples was measured using a

BioPhotometr spectrophotometer (Eppendorf AG, Ham-

burg, Germany) and included a simultaneous qualitative

measurement of the absorbance coefficients A260/A280

and A260/A230. Only samples with the absorbance coef-

ficients respectively above 1.8 and 2.0 were accepted.

Before a reverse transcription reaction started, RNA had

been purified from the remaining DNA using a set of

RNase-free DNase I, in accordance with the manufac-

turer’s instructions.

qPCR. A synthesis of the first cDNA strand was carried

out on the matrix of total isolated RNA using a reverse

transcriptase enzyme (RT). cDNA synthesis was per-

formed using RevertAidTM

H Minus First Strand cDNA

Synthesis Kits in accordance with the manufacturer’s

instructions. Reaction mixture was prepared containing

1 lg RNA in the final volume of 20 ll of reaction mix-

ture. The obtained cDNA was used to analyze an increase

of the product in qPCR. 5 9 HOT FIREPol� EvaGreen�

qPCR Mix Plus (ROX) were performed in accordance

with the manufacturer’s instructions and using oligonu-

cleotide primer pairs summarized in Table 2. Amplifica-

tion was performed in the following temperature–time

profile: 95�C—15 min, then 40 cycles; 95�C—15 s,

60�C—20 s, and 72�C—20 s. The measurement was taken

using the MxPro 30059 camera (qPCR System, Strata-

gene, LaJolla, USA).

As the value of ‘‘slope’’ was determined in accordance

with the formula E (efficiency) = 10(-1/slope) - 1, from a

standard curve, reaction efficiency was calculated for each

qPCR gene. Reaction efficiency for the tested genes ranged

from 100.4 to 103 %. The range of linear correlation

coefficients (R2) describing the linearity of standard curves

for each gene ranged from 0.998 to 0.99. The level of

expression for the selected genes was calculated by relative

quantification (DDCt). The results were normalized in

relation to the level of expression of two genes, BACT and

GADPH, which met the normalization requirements. The

fold change was calculated in accordance with the formula

FC = 2 -DDCt [25, 26]. All calculations were performed by

MxPro QPCR software.

Statistical analysis

To evaluate the statistical significance of the changes in QR

activity and expression of phase 2 and 3 genes the analysis

of variance (ANOVA) by a Duncan post hoc test was used

with the significance level p \ 0.05. The calculations were

performed by Statistica software ver. 9.0 (StatSoft, Inc

USA).

Results

The influence of drugs and ITC on cell viability

As shown in Fig. 1, a 3-h incubation with the drugs alone

and ITC alone has no impact on cell viability. No scheme

of administration influenced significantly cell viability,

except for the highest concentrations of alyssin for which,

in the case of verapamil, a slight but statistically significant

toxic effect was observed (Fig. 1a).

During a 48-h incubation with alyssin and a previous

pre-incubation with alyssin that preceded a 3-h incubation

with drugs, an increase in the concentration resulted in

lowering the vitality (Fig. 1b). The value of IC50 for the

mixture of alyssin and verapamil was slightly lower than

the value of IC50 for alyssin alone. They were 21.9 lM and

24.4 lM, respectively. In the case of the mixture of alyssin

and ketoprofen or furosemide, the IC50 values were slightly

Table 2 The sequence and

concentrations of starters used

in qPCR

Gene and gene accession number Concentration (R. F.) (nM) Primer sequences (50 ? 30)

BACT, NM_001101 100 F: AGTTGCGTTACACCCTTTC

R: ACCTTCACCGTTCCAGTT

GADPH, NM_002046 300 F: AAAGGGTCATCATCTCTG

R: GCTGTTGTCATACTTCTC

MRP1, NM_004996 250 F: ACCAAGTGCTTTCAGAAC

R: AGAGATAGAGGAAGTAGAAGG

PGP, NM_001042371 80 F: GACAGCATAGCCGACCTT

R: CCACTTAGCCGAGCAGAT

GSTM1, NM_000561 300 F: ACCTGTGTTCTCAAAGATGG

R: AGTATGGGCTCCTCACTC

GSTA3, NM_000847 500 F: AGCCATTCTCAACTACATT

R: AATCTGCCATACCTTCTG

22 Mol Cell Biochem (2012) 367:19–29

123

higher than IC50 for alyssin alone, and amounted to

26.1 lM and 29.2 lM, respectively (Table 2).

The changes in QR activity caused by drugs and ITC

In the case of verapamil, a 3-h incubation of cells with the

drugs alone increased the activity by 25 %, while the

incubation with furosemide raised it by about 40 % com-

pared to cells subjected to no compound. A 3-h incubation

with 5 lM alyssin also increased QR activity (Fig. 2a).

Sequential incubation with 2.5 lM alyssin with ketoprofen

and furosemide led to a statistically significant increase in

QR activity by about 40 % compared to the control

(Fig. 2c). As far as the level of the activity for the drugs

alone is concerned, in the case of furosemide and verapa-

mil pre-incubation with 10 lM alyssin decreased QR

activity by more than 40 % (Fig. 2d).

Translocation of the Nrf2 protein

The translocation of Nrf2 into the nucleus occurred 1 h

after incubation of cells with 2.5 and 10 lM alyssin, or

with furosemide and verapamil. After that time, ketoprofen

did not influence the location of the Nrf2 protein, although

it caused translocation after 3 h of incubation (data not

shown). Coincubation with 2.5 and 10 lM alyssin did not

have a significant impact on inducing translocation caused

by furosemide and verapamil. In the case of ketoprofen,

coincubation with 2.5 lM alyssin did not change the

location of this protein. Coincubation with 10 lM alyssin

caused that after 1-h incubation with ketoprofen there was

a definite visible translocation of Nrf2 into the nucleus.

Changes in the expression of GSTM1, GSTA3, MRP1,

and PGP genes caused by ITC and drugs

GSTM1

Among the drugs, only verapamil changed the expression

of this gene—the expression dropped by almost half

compared to control cells. In the case of verapamil and

ketoprofen, pre-incubation with 2.5 lM alyssin increased

GSTM1 expression by over 45 and 65 %, but after pre-

incubation with 10 lM alyssin and then with ketoprofen,

there was a decrease in GSTM1 expression by 40 %

compared to cells subjected to no compound (Fig. 4a).

Sequential incubation of cells with 2.5 lM alyssin and

verapamil or ketoprofen increased GSTM1 expression,

respectively, by about 90 and 60 %, while the interactions

of 10 lM alyssin with furosemide and ketoprofen

decreased GSTM1 expression compared to the incubation

with the drugs alone (Fig. 4b).

GSTA3

GSTA3 expression was reduced by more than half after the

incubation with the drugs alone. Also, the incubation with

10 lM alyssin significantly decreased the expression of

this gene. However, after sequential incubation with alys-

sin and the drugs, gene expression in each case was

Fig. 1 Effect of alyssin and

drugs on viability in Caco-2

cells. a at 3-h simultative

incubation. b 48-h subsequent

incubation with 2.5–40 lM

alyssin and 3 h with 0.25 mM

of drugs: verapamil, ketoprofen,

and furosemide. Viability is

presented as a percentage of

control, without treatment.

*\0.05

Mol Cell Biochem (2012) 367:19–29 23

123

significantly different from that observed in cells subjected

to no compound. In the case of verapamil, pre-incubation

with 2.5 increased GSTA3 expression, while the pre-

incubation with 10 lM alyssin with this drug decreased

GSTA3 expression compared to control cells. In the case of

furosemide, pre-incubation with 2.5 and 10 lM alyssin

increased GSTA3 expression by over 60 % and about

140 %, respectively, to cells subjected to no compound

(Fig. 4c). In the case of ketoprofen, there were drops in

gene expression compared to the control. An increase in

GSTA3 expression compared to that observed for the drugs

alone was 85 % and 120 % for verapamil and furosemide,

respectively, in the case of pre-incubation with 2.5 lM

alyssin. At the same time, pre-incubation with 10 lM

alyssin reduced GSTA3 expression for ketoprofen and

increased for verapamil and furosemide by less than 40 and

200 %, respectively (Fig. 4d).

MRP1

The incubation of cells with verapamil and ketoprofen

decreased the expression by approximately 50 %

compared to control cells. Treating cells with 10 lM

alyssin and verapamil or furosemide and 2.5 lM alyssin

and furosemide increased the expression of this gene by

more than 30 % compared to control cells (Fig. 4e). Pre-

incubation of cells with alyssin significantly increased

MRP1 expression in comparison with the levels observed

for the drugs alone. In the case of furosemide, the growths

of expression were the smallest. There was an increase in

MRP1 expression by over 60 % for ketoprofen and

verapamil. Only for 10 lM alyssin and verapamil this

increase exceeded 80 % compared to the incubation with

the drugs alone (Fig. 4f).

PGP

The incubation with ITC did not have a statistically sig-

nificant impact on the expression of this gene. Pre-incu-

bation with alyssin, in the case of furosemide and

ketoprofen (only 2.5 lM), increased the expression by

35 % compared to the incubation with the drugs alone

(Fig. 4h).

Fig. 2 Effect of alyssin and drugs on QR activity in Caco-2 cells.

a and b At 3-h simultative incubation with 5 lM alyssin. c and d. At

32-h subsequent incubation with 2.5 and 10 lM alyssin and 3 h with

0.25 mM of drugs: verapamil, ketoprofen, and furosemide. a and

c The QR activity is presented as a percentage of the control, without

treatment. b and d. The QR activity is presented as a deviation from

the QR activity of the drugs. *\0.05

24 Mol Cell Biochem (2012) 367:19–29

123

Discussion

An uncontrolled consumption of dietary supplements (for

example ITCs), along with the drugs routinely used by

people may have an unpredictable effect due to the possi-

bility of interactions between them. The aim of this study

was to investigate a possibility of interactions between

alyssin and drugs (verapamil, ketoprofen, and furosemide)

that modulate cell metabolism through the impact on the 2

and the 3 phase of metabolism and to check whether the

transcription factor Nrf2 is involved in the mechanism of

these interactions.

The obtained data showed the existence of interaction

between the tested drugs and alyssin, which have an effect

on cell metabolism. The interactions between alyssin and

the drugs led to small changes in cell viability compared to

separate incubation (Fig. 1). According to the results of

viability, IC50 values for alyssin alone do not differ sta-

tistically significantly from the IC50 values for alyssin

given in combination with drugs (Table 1). This indicates

that no interactions leading to cellular apoptosis or necrosis

between alyssin and the drugs occurs.

For the Nrf2 translocation, QR enzyme activity and gene

expression, we use concentrations which do not cause a

Fig. 3 A localization of Nrf2 in Caco-2 cells after 1-h simultative

incubation with 2.5 and 10 lM alyssin and 0.25 mM of drugs:

verapamil, ketoprofen, and furosemide. a Cells incubated with

medium only (control cells) and with 2.5 and 10 lM alyssin.

b Cells incubated with drugs separately or simultative incubation,

alyssin with drugs. The cells with fluorescent-labeled Nrf2 are

presented. When Nrf2 is localized in cytoplasm and no translocation

occurs, then there is no fluorescence signal originating from the

nuclei, while strong fluorescence is visible in the cytoplasm.

Conversely, when the fluorescence is present in the nuclei, it indicates

that Nrf2 translocation has taken place

Mol Cell Biochem (2012) 367:19–29 25

123

decrease in cell viability, according to cytotoxictiy tests

this concentration was up to 10 lM. It is a well-known fact

that phase 2 enzymes are regulated chiefly by the tran-

scription factor Nrf2, which interacts with the ARE

sequence located in the promoter regions of these genes. As

the MRP transport proteins also contain the ARE sequence

in their promoter region, they can also be regulated by Nrf2

and thus by substances that induce the translocation of Nrf2

into the cell nucleus [27]. The observed changes in cell

metabolism to some extent depended on Nrf2 translocation

from the cytoplasm into the nucleus. We have shown that

both drugs and alyssin caused Nrf2 translocation. Co-

administration of alyssin with verapamil and with furose-

mide did not change the profile of translocation (Fig. 3),

yet there were changes in the 2nd and 3rd phase as a result

of the interactions. As far as coincubation of alyssin with

ketoprofen is concerned, ketoprofen inhibits the translo-

cation of Nrf2 induced by a lower concentration of alyssin,

while the interaction of ketoprofen with 10 lM alyssin

eliminates the inhibitory effect of ketoprofen. Interestingly,

there was no correlation between Nrf2 translocation and

the interactions that occurred. This indicates the possibility

of yet another mechanism responsible for regulating the

activity of the detoxification system in cells.

Deciding whether the interaction was positive or nega-

tive depends on the effect we had expected from the drug.

There are known interactions of nonsteroidal anti-inflam-

matory drugs (NSAIDs), including ketoprofen with the

drugs used in the treatment, among other things, cancers

and other diseases. Coadministration of a cytostatic

Methotrexate (MTX) with NSAIDs contributed to the toxic

growth of the concentration of this drug in the cell, which

causes numerous side effects. The accumulation of MTX in

cells results from the inhibition of its transport that is

dependent on the MRP proteins [28]. Our laboratory data

confirmed that ketoprofen inhibits MRP (here MRP1)

(Fig. 4e). The interactions between ketoprofen and alyssin

changed cellular response to this drug by eliminating an

inhibitory effect of ketoprofen on the MRP1 expression. In

addition, sequential administration of a lower concentration

of alyssin with ketoprofen increased QR activity and the

expression of GSTM1 gene. These interactions could lead

to a faster metabolism and throwing the drug out of the

cell, thereby preventing from its toxic activity.

Also, an increase in QR activity, a marker of cytopro-

tective enzymes that is regulated by Nrf2 [29, 30], which is

caused by the action of alyssin or the interaction, seems to

have a beneficial effect in the case of b-lapachone, an

antineoplastic substance having a selective cytotoxic effect

on non-small lung cancer cells, in which the overexpres-

sion of QR was reported. In this case, further expression of

this enzyme could enhance the cytostatic effect of b-

lapachone [31]. It should also be noted that a growth in the

expression of the phase 2 enzymes in normal cells leads to

their protection against carcinogenic agents; consequently,

the medications the interactions of which increase the

expression of these enzymes would have chemopreventive

properties. However, on the other hand, as far as MDR is

concerned, and the fact that it is largely connected with the

action of PGP and MRP1 proteins, the interactions between

the drugs and alyssin seem to be unfavorable. It is a well-

known fact that the drugs, we have tested, have an impact

on MDR. Furosemide is involved in reducing MDR and as

such it has an indirect effect on PGP activity in bladder

cancer cells [32]. At the same time, verapamil is an

inhibitor of MRP and PGP, having a cytostatic effect on

cells that reveal overexpression of MRP1 by stimulating

GSH extrusion medial stimulation by MRP1 [33]. The

sequential administration of alyssin with verapamil or with

furosemide eliminated the inhibitory effect of these drugs

on MRP1. In the case of PGP, the drugs alone did not

affect the level of expression of this gene, but the inter-

actions of alyssin with ketoprofen or with furosemide

increased its expression. Eliminating the inhibitory effect

of the drugs on the expression of membrane transporters

may modify drug transport and desensitize cells to cyto-

static drugs used and in this way induce MDR.

Also, GSTs (GSTP1 isoenzymes, GSTA1, and GSTM)

participate in MDR by, among other things, synergistic

acting with MRP [34]. The drugs that we have tested are

also associated with the 2 phase of metabolism. Ketoprofen

[35] and verapamil [36] are inhibitors of GSTs. GSTs are

also involved in furosemide metabolism [37]. In our

experiment, all drugs reduced GSTA3 expression, while

only verapamil was responsible for the reduction of

GSTM1 expression.

As far as GSTs are concerned, it is a well-known fact

that depending on the type of cells, different isoforms of

GST are expressed and depending on the type of tissue. For

this reason, the effect of interaction on this enzyme could

be more diverse. Moreover, tumor cells that exhibit MDR

have a higher level of phase 2 enzymes, including GSTs

and QR compared to normal cells [34], and their further

stimulation may increase metabolism of cytostatic drugs

and induce further development of MDR. The interactions

of alyssin with verapamil and with furosemide that elimi-

nate the inhibitory effect of these drugs on GSTA3 as well

as the interactions between lower alyssin concentrations

Fig. 4 Expression levels of genes: GSTM1, GSTA3, MRP1, and

PGP. At 24-h subsequent incubation of Caco-2 cells with 2.5 and

10 lM alyssin and 3 h with 0.25 mM of drugs: verapamil, ketopro-

fen, and furosemide. A control sample is used as a calibrator to

generate fold change values = 2-(DDc). a, c, e, and g The expression

is presented as a percentage of the control, without treatment. b, d, f,and h. The expression is presented as a deviation from the

GSTM1,GSTA3,MRP1, and PGP expression levels of the drugs.

*p \ 0.05

c

26 Mol Cell Biochem (2012) 367:19–29

123

Mol Cell Biochem (2012) 367:19–29 27

123

and verapamil and ketoprofen that eliminate the inhibitory

effect on GSTM1 could decrease the sensitivity of cells to

cytostatic drugs. On the other hand, the interactions

between higher concentrations of alyssin with ketoprofen

and furosemide that strength the inhibitory effect of the

drug on GSTM1 and the interactions with ketoprofen and

furosemide, with their impact on GSTA3 could make cells

more sensitive to the used medications.

The conducted experiments show that the effects of

interactions on the 2 phase of metabolism varied;

strengthening or weakening of the activity of the drugs

given separately depended on the concentration of alyssin,

type of the drug, and GST isoform. A similar situation was

observed in the case of QR, where sequential (higher

concentration of alyssin) and simultative administration of

alyssin eliminated a stimulating effect of verapamil and

furosemide on the activity of this enzyme. At the same

time, sequential administration of lower concentrations of

alyssin with ketoprofen increased QR activity.

These results, for the first time, showed in Caco-2 cells

the possibility of interactions between drugs commonly

used by people and alyssin—a substance having chemo-

preventive properties. These interactions may contribute to

changes in the metabolism of drugs as such, as well as

alternations in other metabolic pathways in cells. It was

observed that the interactions between lower concentra-

tions of alyssin and the drugs either increased the level of

phase 2 and 3 enzymes or did not affect the drug activity.

The interactions with a higher dose of alyssin have a highly

stimulating effect on the expression of phase 3 metabolic

genes and a diverse effect on the 2 phase. These interac-

tions can cause unexpected effects that alter the action of

each taken component separately or affect metabolism and

therapeutic strength of other drugs.

Acknowledgments This work was supported by a grant from the

Ministry of Science and Higher Education no. N405302236.

References

1. Kennedy J (2005) Herb and supplement use in the US adult

population. Clin Ther 27:1847–1858

2. Yoon SL, Schaffer SD (2006) Herbal, prescribed, and over-the-

counter drug use in older women: prevalence of drug interactions.

Geriatr Nurs 27:118–129

3. Gardnier P, Phillips R, Shaughnessy AF (2008) Herbal and die-

tary supplement–drug interactions in patients with chronic ill-

nesses. Am Fam Phys 77:73–78

4. Abebe W (2002) Herbal medication: potential for adverse inter-

actions with analgesic drugs. J Clin Pharm Ther 27:391–401

5. Bailey DG, Dresser GK, Kreeft JH, Munoz C, Freeman DJ, Bend

JR (2000) Grapefruit-felodipine interaction: effect of unprocessed

fruit and probable active ingredients. Clin Pharmacol Ther

68:468–477

6. Bailey DG, Arnold MO, Spence JD (1998) Grapefruit juice–drug

interactions. Br J Clin Pharmacol 46:101–110

7. Keum YS, Jeong WS, Kong AN (2002) Chemoprevention by

isothiocyanates and their underlying molecular signaling mech-

anisms. Mutat Res 555:191–202

8. Nguyen T, Sherratt PJ, Pickett CB (2003) Regulatory mecha-

nisms controlling gene expression by the antioxidant response

element. Annu Rev Pharmacol Toxicol 43:233–260

9. Sekhar KR, Spitz DR, Harris S, Nguyen TT, Meredith MJ, Holt

JT, Gius D, Marnett LJ, Summar ML, Freeman ML (2002)

Redox-sensitive interaction between KIAA0132 and Nrf2 medi-

ates indomethacin-induced expression of gamma-glutamylcys-

teine synthetase. Free Radic Biol Med 32:650–662

10. Wang XJ, Hayes JD, Wolf CR (2006) Generation of a stable

antioxidant response element-driven reporter gene cell line and

its use to show redox-dependent activation of Nrf2 by cancer

chemotherapeutic agents. Cancer Res 66:10983–10994

11. Gong YP, Liu T, Jia YQ, Qin L, Deng CQ, Yang RY (2002)

Comparison of Pgp- and MRP-mediated multidrug resistance in

leukemia cell lines. Int J Hematol 75:154–160

12. Hu R, Shen G, Yerramilli UR, Lin W, Xu C, Nair S, Kong AN

(2006) In vivo pharmacokinetics, activation of MAPK signaling

and induction of phase II/III drug metabolizing enzymes/trans-

porters by cancer chemopreventive compound BHA in the mice.

Arch Pharm Res 29:911–920

13. Takahashi K, Shibata T, Oba T, Ishikawa T, Yoshikawa M,

Tatsunami R, Takahashi K, Tampo Y (2009) Multidrug-resis-

tance-associated protein plays a protective role in menadione-

induced oxidative stress in endothelial cells. Life Sci 84:211–217

14. Harris KE, Jeffery EH (2008) Sulforaphane and erucin increase

MRP1 and MRP2 in human carcinoma cell lines. J Nutr Biochem

19:246–254

15. Kjær A (1960) Naturally derived isothiocyanates (mustard oils)

and their parent glucosides. Fortschr Chem Org Naturst 18:

122–176

16. Misiewicz I, Skupinska K, Kasprzycka-Guttman T (2007) Dif-

ferential response of human healthy lymphoblastoid and CCRF-

SB leukemia cells to sulforaphane and its two analogues: 2-ox-

ohexyl isothiocyanate and alyssin. Pharmacol Rep 59:80–87

17. Laitinen LA, Tammela PS, Galkin A, Vuorela HJ, Marvola ML,

Vuorela PM (2004) Effects of extracts of commonly consumed

food supplements and food fractions on the permeability of drugs

across Caco-2 cell monolayers. Pharm Res 21:1904–1916

18. Svehlıkova V, Wang S, Jakubıkova J, Williamson G, Mithen R,

Bao Y (2004) Interactions between sulforaphane and apigenin in

the induction of UGT1A1 and GSTA1 in Caco-2 cells. Carci-

nogenesis 25:1629–1637

19. Jakubıkova J, Sedlak J, Bod’o J, Bao Y (2006) Effect of iso-

thiocyanates on nuclear accumulation of NF-kappaB, Nrf2, and

thioredoxin in caco-2 cells. J Agric Food Chem 8:1656–1662

20. Weglarz L, Parfiniewicz B, Orchel A, Dzierzewicz Z (2006)

Anti-proliferative effects of inositol hexaphosphate and verapa-

mil on human colon cancer Caco-2 and HT-29 cells. Acta Pol

Pharm 63:443–445

21. Schmidt H, Karrer P (1948) Synthese der racemischen und der

optisch aktiven Formen des Sulforaphans. Helv Chim Acta

31:1497–1505

22. Denizot F, Lang R (1986) Rapid colorimetric, assay for cell

growth and survival modifications to the tetrazolium dye proce-

dure giving improved sensitivity and reliability. J Immunol

Methods 89:271–277

23. Bradford MM (1976) A rapid sensitive method for the quantita-

tion of microgram quantitities of protein utilizing the principle of

protein-dye binding. Anal Biochem 72:248–254

24. Prohazka HJ, Santamaria AB (1988) Direct measurement of

NAD(P)H: quinone reductase from cells cultured in microtiter

28 Mol Cell Biochem (2012) 367:19–29

123

wells:a screening assay for anticarcinogenic enzymes inducers.

Anal Biochem 169:328–336

25. Butin SA (2005) Quantification of mRNA using real-time reverse

transcription PCR (RT-PCR): trends and problems. J Mol

Endocrinol 25:169–193

26. Livak KJ, Schmittgen TD (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the 2 (-Delta

Delta C(T)) method. Methods 25:402–408

27. Shen G, Kong AN (2009) Nrf2 plays an important role in coor-

dinated regulation of phase II drug metabolize enzymes and

phase III drug transporters. Biopharm Drug Dispos 30:345–355

28. El-Sheikh AA, van den Heuvel JJ, Koenderink JB, Russel FG

(2007) Interaction of nonsteroidal anti-inflammatory drugs with

multidrug resistance protein (MRP) 2/ABCC2- and MRP4/

ABCC4-mediated methotrexate transport. J Pharmacol Exp Ther

320:229–235

29. McWalter GK, Higgins LG, McLellan LI, Henderson CJ, Song L,

Thornalley PJ, Itoh K, Yamamoto M, Hayes JD (2004) Tran-

scription factor Nrf2 is essential for induction of NAD(P)H:qui-

none oxidoreductase 1, glutathione S-transferases, and glutamate

cysteine ligase by broccoli seeds and isothiocyanates. J Nutr

134:3499S–3506S

30. Dinkova-Kostova AT, Talalay P (2010) NAD(P)H:quinone

acceptor oxidoreductase 1 (NQO1), a multifunctional antioxidant

enzyme and exceptionally versatile cytoprotector. Arch Biochem

Biophys 501:116–123

31. Bey EA, Bentle MS, Reinicke KE, Dong Y, Yang CR, Girard L,

Minna JD, Bornmann WG, Gao J, Boothman DA (2007) An

NQO1- and PARP-1-mediated cell death pathway induced in

non-small-cell lung cancer cells by b-lapachone. Proc Natl Acad

Sci 104:11832–11837

32. Speers AG, Lwaleed BA, Featherstone JM, Sallis BJ, Cooper AJ

(2006) Furosemide reverses multidrug resistance status in bladder

cancer cells in vitro. J Clin Pathol 59:912–915

33. Trompier D, Chang XB, Barattin R, du Moulinet D’Hardemare

A, Di Pietro A, Baubichon-Cortay H (2004) Verapamil and its

derivative trigger apoptosis through glutathione extrusion by

multidrug resistance protein MRP. Cancer Res 64:4950–4956

34. Depeille P, Cuq P, Mary S, Passagne I, Evrard A, Cupissol D,

Vian L (2004) Glutathione S-transferase M1 and multidrug

resistance protein 1 act in synergy to protect melanoma cells from

vincristine effects. Mol Pharmacol 65:897–905

35. Sadzuka Y, Shimizu Y, Takino Y, Hirota S (1994) Protection

against cisplatin-induced nephrotoxicity in the rat by inducers

and an inhibitor of glutathione S-transferase. Biochem Pharmacol

48:453–459

36. Kaplowitz N, Clifton G, Kuhlenkamp J, Wallin JD (1976)

Comparison of renal and hepatic glutathione S-transferases in the

rat. Biochem J 158:243–248

37. Josephy PD (2010) Genetic variations in human glutathione

transferase enzymes: significance for pharmacology and toxi-

cology. Hum Genomics Proteomics 13:876940

Mol Cell Biochem (2012) 367:19–29 29

123