S1
Supplementary information for:
New Dual Functional Salts Based on Cationic
Derivative of Plant Resistance Inducer –
Benzo[1.2.3]thiadiazole-7-carbothioic Acid, S-
Methyl Ester
Marcin Smiglak,*,†, ‡ Rafal Kukawka,‡ Piotr Lewandowski,‡ Marta Budziszewska,§ Aleksandra
Obrępalska-Stęplowska,§ Krzysztof Krawczyk,§ Agnieszka Zwolińska,§ Henryk Pospieszny§
† Dr. M. Smiglak
Poznan Science and Technology Park
Adam Mickiewicz University Foundation
ul. Rubież 46, 61-612 Poznań, Poland
‡ MSc. R. Kukawka, MSc. P. Lewandowski
Faculty of Chemistry
Adam Mickiewicz University
ul. Umultowska 89b, 61-614 Poznań, Poland.
§ Prof. H. Pospieszny, Dr A. Obrępalska-Stęplowska, Dr. K. Krawczyk, Dr M. Budziszewska,
MSc. A. Zwolinska
Institute of Plant Protection – National Research Institute
ul. W. Węgorka 20, 60-318 Poznań, Poland
S2
Number of pages: 24
Number of figures: 3
Number of tables: 2
S3
Figures:
Figure S1. Thermal stability of [BTHCOOH(Me)]+ salts --▲-- (11), —△— (12), —◆— (13), --◆-- (14), —◼— (15), --◌-- (16)
Figure S2. Dissolution rate of [BTHCOOH(Me)]+ derivatives --▲-- (11), —△— (12), —◆— (13), —◼— (15),--◌-- (16)
Temperature [oC]
0 50 100 150 200 250 300 350 400 450 500
Wei
gh
t [%
]
0
10
20
30
40
50
60
70
80
90
100
BTHCOOH
[BTHCOOH(Me)][MeSO4]
[BTHCOOH(Me)][[NTf2]
[BTHCOOH(Me)][Doc]
[BTHCOO(Me)]+/-
[BTHCOOH(Me)][I]
Time [s]
0 500 1000 1500 2000 2500
A\b
sorb
an
ce [
%]
0
10
20
30
40
50
60
70
80
90
100
BTHCOOH
[BTHCOOH(Me)][Doc]
[BTHCOOH(Me)][NTf2]
[BTHCOOH(Me)][MeSO4]
[BTHCOO(Me)]+/-
S4
Figure S3. Phytotoxicity on tobacco plants after watering with 50 ml solution of [BTHMe][MeSO4] (2) at the concentration 20mg/l (left) and control (right)
Tables:
Table S1. MIC and MBC values of the tested salts (concentration in mg/l). The list of the salts is given in Table 1.
Strain (2) (3) (4) (5) (6) (7) (8) (9) (12) (13) (14) (15) (16)
Cocci
S. aureus MIC 125 — 1000 1000 175 253 — 1013 673 — — — 997
Rods MBC 125 — — — — 253 — 1013 673 — — — 997
E. coli MIC 667 — — — — 675 — — — — — — —
MBC 667 — — — — 675 — — — — — — —
P. carotovorum MIC 500 — — — 175 253 — — — — — —
MBC 500 — — — — 253 — — — — — —
P. syringae MIC 125 1000 1000 1000 175 253 — — 253 125 1000 80 997
MBC 125 1000 1000 1000 175 253 — — 253 125 1000 160 997
Maximal. non
phytotoxic
concentration
of the salts
tested
1000 1000 1000 1000 175 1012 1024 1013 1010 1002 1000 638 997
Legend: MIC (Minimal Inhibitory Concentration) - the lowest concentration of tested substances at which there was no visible bacterial growth (mg/l). MBC
(Minimum Bactericidal Concentration) - the lowest concentration of the salts supporting no bacterial colony formation (mg/l).
Symbol “— “ means that at maximum tested concentration (~1000 mg/l) the salts showed no antibacterial activity, hence pointing that its MIC and MBC at these
concentrations were not possible to be determined.
S5
Table 2. Characteristic wavelength (maximum
of absorbance) used for determination
dissolution rate
Compound Characteristic
wavelength [nm]
BTH (1) 338
[BTHMe][MeSO4] (2) 312
[BTHMe][I] (3) 292
[BTHMe][OTf] (4) 322
[BTHMe][Cl] (5) 285
[BTHMe][NTf2] (6)28 338
[BTHMe][Doc] (7)28 316
[BTHMe][MES] (8) 322
[BTHMe][LS] (9) 285
BTHCOOH (11) 316
[BTHCOO(Me)]+/- (12) 299
[BTHCOOH(Me)][MeSO4]
(13)
360
[BTHCOOH(Me)][I] (14) 292
[BTHCOOH(Me)][NTf2]
(15)
299
[BTHCOOH(Me)][Doc]
(16)
322
S6
Experimental Section
Synthesis and physicochemical properties of the precursors ([BTHMe][MeSO4] (2),
[Na][BTHCOO] (10) and BTHCOOH (11)), used to obtain new compounds, have been reported
in papers by Smiglak et al.[E1,E2] Furthermore, the methods for preparation, physical properties
and the level of induction of plant resistance caused by the compounds: [BTHMe][OTf] (4),
[BTHMe][NTf2] (6) and [BTHMe][Doc] (7) were reported in the earlier article.[E2] Data for those
compounds is incorporated in the article to present physical and biological properties of series of
BTH cationic derivatives and to expand research on antibacterial tests of these compounds.
Methods
New BTH salts were characterized using Nuclear Magnetic Resonance and Infrared Spectroscopy.
The methods for obtaining thermal, spectroscopic and others data are described below.
NMR
H NMR spectra were recorded on a Varian XL 300 NMR (300 MHz) using d6-DMSO as solvent
with tetreamethylsilane as the internal standard. Proton chemical shifts are shown in parts per
million (δ ppm). C NMR spectra were obtained in the same instrument at 75 MHz.
Thermal analysis
Melting points were determined using DSC method in STARe System (Mettler Toledo). Samples
used were between 6 – 15 mg, closed in aluminum pans and stored under argon atmosphere (flow
rate: 20 ml/min). In the first heating cycle the heating ramp was set from 25 to maximum
temperature (160oC for compounds: BTH (1), [BTHMe][MeSO4] (2), [BTHMe][I] (3),
[BTHMe][NTf2] (6), [BTHMe][Doc] (7), [BTHMe][LS] (9) and 230oC for compounds:
S7
[BTHMe][OTf] (4), [BTHMe][Cl] (5), [BTHMe][MES] (8), [BTHCOO(Me)]+/- (12),
[BTHCOOH(Me)][MeSO4] (13), [BTHCOOH(Me)][I] (14), [BTHCOOH(Me)][NTf2] (15),
[BTHCOOH(Me)[Doc] (16)) and 270oC for compound: BTHCOOH (11)), with heating rate
10oC/min. At this temperature samples were held for a 5 minutes isotherm. In the next step samples
were cooled from the maximum temperature to -50oC with cooling rate 10oC /min, and then were
kept for 5 min at -50oC. The last step was heating sample from -50oC back to the maximum
temperature (as described above) with heating rate 10oC/min.
Thermogravimetric analyses were performed on TGA Q50 Texas Instrument. Samples between 5
and 10 mg were heated form 25oC to 500oC with heating rate of 10oC/min with a 10 min isotherm
at 80oC under nitrogen atmosphere. This isotherm step was intended to remove any remaining
water and possible volatile impurities present in the samples. Decomposition temperatures reported
for all materials were established as the onset temperature for decomposition of the first 5% of the
sample (T5%onset), and as the regular onset temperature for decomposition (Tonset), either for the
whole sample or for each of the consecutive steps in stepwise decomposition
Solubility analysis
Solubility in water was determined in two ways. Every compound (100 mg) was dissolved in 10
ml of water at room temperature during 1 hour time. The procedure was repeated three times. The
compounds which completely dissolved at that time were described as: soluble in water >10g/l. If
the compound did not dissolve in 1 hour time (e.g. [BTHMe][NTf2] (6) and
[BTHCOOH(Me)][NTf2] (15)), second experiment was performed to determine the maximum
solubility in water. 10 mg of compound was placed in flask with magnetic stirrer with 100 ml of
water for 24 hours. If all of the sample was dissolved, after one day next portion (10 mg) was
S8
added. Next portions were added until part of compound was no dissolved. Then the procedure was
repeated by dissolving just the determined maximum amount of a compound in water and next
adding new portion of the substance in an amount of 1 mg until no further dissolution was observed.
Dissolution rate
To determine dissolution rate the system for continuous flow measurement of absorbance of
tested substances was constructed and used. For every compound, characteristic wavelength (Table
S2 ) at which the absorbance of compound was at the maximum, was determined by UV-Vis.
Following this step, salt samples of the tested compounds (the mass of each sample between 4 and
10 mg, always below maximum solubility as determined in separate experiment) were placed in
the mashed cellulose bag in conical flask filed with 140 cm3 of distilled water with magnetic stirrer
(250 rpm). Using peristaltic pump the solution from the flask, where the dissolution experiment
was conducted, was transferred to the UV spectrometer and after passing through the UV cell, back
to the experiment flask in order to form a closed system. The absorbance of the solution was
measured constantly at the wavelength earlier determined as maximum absorption for particular
compound. Each experiment was carried until all tested sample was completely dissolved.
Dissolution rate of examined compounds was compared to the dissolution rates of neutral BTH and
BTHCOOH on relative scale. The relative dissolution rate was determined by dividing the amount
of time required for the absorbance to reached 95% of the maximum absorbance for investigated
compound vs starting material (BTH or BTHCOOH). The results are shown in graphs where x-
axis represents dissolution time and y-axis is % of absorbance of compound (100% absorbance is
absorbance of fully dissolved compound).
S9
LogP determination
The LogP values were determined for all of reported compounds by using standard OECD
procedure utilizing reverse phase HPLC method.[E3] Samples were dissolved in mixture of HPLC
grade methanol and water (75:25 v/v) in concentration 0.6 mg/mL. Prepared samples were analyzed
using a Acquity UPLC BEH C18 1.7μm column by Waters with a mobile phase of methanol and
water (75:25 v/v) with a flow rate of 0.5 and 0.25 mL/min and detected by PDA detector. Due to
specificity of selected HPLC method for the determination of logP values of organic compounds
only values of logP between 0 and 6 can be determined. All compounds with logP values <0 exhibit
retention time on the column = T0 and thus could not be measured correctly. The standard curve
was generated by using materials of known logP values, nicotinic acid (0.07), butanone (0.30),
benzyl alcohol (1.10), methyl benzoate (2.10), ethyl benzoate (2.60) toluene (2.70) and naphthalene
(3.60) as references. Retention times were collected in triplicates for each of references and
analyzed salts. The eluent flow rate was set to 0.025 ml/min and the column temperature was set
at 30 oC. Retention times of reference compounds were adjusted for the T0 (359 s for 0.025
mL/min), and a standard curve of logP vs. retention time was generated (R2 = 0,998). Values of
logP for analyzed new salts, based on their the retention time, were calculated using equation of
the calibration curve.
pKa value determination
In order to calculate pKa values, the dissociation constant (Ka) of salts (13) - (16) containing
carboxylic acid group was determined using conductometric method with pH/conductivity meter
CPC-411 ELMEIRA with EC-60 ELMEIRA electrode. Conductance was measured for each
substance in prepared solutions with decreasing concentratios: 0.04, 0.02 0.01, 0.005 0.0025, 0.002
S10
and 0.001 [mol/l] for salts [BTHCOOH(Me)][MeSO4] (13), [BTHCOOH(Me)][I] (14), and
[BTHCOOH(Me)][Doc] (16). For [BTHCOOH(Me)][NTf2] (15) solutions were prepared in
concentrations: 0.01, 0.005, 0.0025, 0.002, 0.00125, 0.001, 0.0005 [mol/dm3] due to low solubility
in water. Due to low solubility in water the pKa was not determined for BTHCOOH (11). Prepared
solutions were thermostated at 25°C and conductance (G) was measured. Knowing the cell constant
(K = 0.95), the conductivity (κ) and molar conductivities (Λm) were calculated. The resulting
experimental data were plotted as y= 1/Λm i x = κ (R2 > 0.97). A and b parameters of linear
regression equation were calculated and used for calculation of dissociation constant (eq1).
(eq1)
pKa was calculated from Ka through mathematical conversion pKa=-logKa.
Synthesis
Preparation of salts with cations derived from benzo[1.2.3]thiadiazole-7-carbothioic acid, S-methyl
ester (BTH) and benzo[1.2.3]thiadiazole-7-carboxylic acid (BTHCOOH).
Reported new dual functional salts of BTH (1) and BTHCOOH (11) were prepared via alkylation
reaction of neutral BTH or BTHCOOH in order to form cationic derivatives (Figure 8 and 9) and
then, using one of three general methods for the anion exchange, total of 9 new products (out of 13
reported) was obtained. The anion exchange reactions were performed via (i) use of ion exchange
acidic resin, (ii) biphasic solvent extraction and (iii) by precipitation of product. Out of all reported
compounds, salts [Na][BTHCOO] (10), [BTHMe][OTf] (4), [BTHMe][MeSO4] (2),
[BTHMe][Doc] (7), [BTHMe][NTf2] (6) and neutral compound BTHCOOH (11) were already
𝐾𝑎 =1
𝑎(103 ∗ 𝐶𝑚𝑜𝑙)∗ 𝑏2
S11
described by us in earlier reports[1,2] but their physicochemical and biological properties needed
to be determined in order to present the whole series of derivatives and the trends in their changes.
Methylation reaction
3-methyl-benzo[1.2.3]thiadiazolium-7-carboxylic acid methyl sulfate,
[BTHCOOH(Me)][MeSO4], (13)
Three-neck flask equipped with reflux condenser was placed on the magnetic stirrer and
BTHCOOH (11) (0.5 g, 2.77 x 10-3 mol) was added and heated to 120oC while purging with argon.
After 3 minutes Me2SO4 (0.7 g, 5.5 x 10-3 mol) was added and all BTHCOOH immediately
dissolved in it. The reaction was stopped after 5 minutes and cooled to the room temperature. The
product was isolated from the solution as crystalline material by slowly cooling of the reaction
mixture and later by filtration. To the solid product acetone (10 ml) was added to wash out excess
of Me2SO4, unreacted BTHCOOH and other impurities. Such solution was stirred for 2 hours to
obtain powdery pink product. The IR, and NMR analysis confirmed obtaining of product 3-methyl-
benzo[1,2,3]thiadiazol-3-ium 7-carboxylic acid methyl sulfate with yield: 80 %.
m.p. 204.7oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS): δ/ppm = 9.05 (1 H, d, C(6)H), 8.58
(1 H, t, C(6)H), 8.31 (1 H, d, C(6)H), 5.00 (3 H, s, NMe); 13C NMR (75 MHz, [D6]DMSO, TMS):
δ/ppm = 166.8, 146.8, 144.7, 133.3, 132.9, 125.3, 122.9, 46.3; IR: ν/cm-1 = 3082, 3042, 2732, 2456,
1681, 1661, 1582, 1489, 1444, 1316, 1215, 1131, 1062, 1018, 874, 816, 765, 704, 592, 573.
S12
3-methyl-benzo[1.2.3]thiadiazolium-7-carbothioic acid, S – methyl ester iodide, [BTHMe][I],
(3)
To the pressure tube with capacity of 20 ml with magnetic stirrer BTH (1) (0.5 g, 2.38 x 10-3 mol)
and methyl iodide (MeI) (0.69 g, 4.76 x 10 -3 mol) were added. The pressure tube was sealed and
heated to 100oC for 18 hours. BTH was dissolved in MeI at 80oC. During the reaction, solution
changed colour from light yellow to bottle green. After cooling to room temperature remaining
unreacted BTH immediately precipitated. After carefully opening reaction vessel, water was added
and mixture was vigorously shaken in order to separate product from water insoluble BTH. Water
phase was separated out and evaporated. Red crystals of 3-methyl-benzo[1.2.3]thiadiazolium 7-
carbothioc acid, S – methyl ester iodide with yield: 8% were obtained as confirmed by NMR.
m.p. 112.9oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS)) δ/ppm = 9.19 (1 H, d, C(6)H), 8.87
(1 H, t, C(6)H), 8.36 (1 H, d, C(6)H), 5.03 (3 H, s, NMe), 2.70 (3 H, s, SMe); 13C NMR (75 MHz,
[D6]DMSO, TMS) δ/ppm = 192.0, 148.2, 142.6, 134.1, 132.7, 130.4, 124.7, 47.0, 12.8; IR: ν/cm-1
= 2981, 2917, 1620, 1508, 1572, 1479, 1439, 1329, 1252, 1199, 1085, 1068, 997, 878, 845, 797,
725, 701, 673.
3-methyl-benzo[1.2.3]thiadiazolium-7-carboxylate (zwitterion), [BTHCOO(Me)]+/-, (12)
Into the three-neck flask under reflux condenser with magnetic stirrer sodium
benzo[1.2.3]thiadiazole-7-carboxylate ([Na][BTHCOO]) (10) (0.5 g, 2.77 x 10-3 mol), obtained as
described in literature[27] was added and heated to 120oC while purging with argon. Than Me2SO4
(0.7 g, 5.5 x 10-3 mol) was added and immediately all of [Na][BTHCOO] dissolved in it. After two
minutes the reaction mixture turn brown. The reaction was stopped and cooled to the room
temperature. While the solution was being cooled down, it crystalized. To the solid product dry
S13
methanol (10 ml) was added to precipitate the byproduct [Na][MeSO4]. Methanol phase was
evaporated and obtained product was again dissolved in methanol (5 ml). After that the mixture
was added dropwise to diethyl ether (30 ml), white powder precipitated and was separated. The IR
and NMR analysis confirmed obtaining product 3-methyl-benzo[1.2.3]thiadiazol-3-ium-7-
carboxylate with yield: 65 %.
m.p. 201.8oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 8.7 (1 H, d, C(6)H), 8.2 (1
H, t, C(6)H), 8.1 (1 H, d, C(6)H), 4.9 (3 H, s, NMe); 13C NMR (75 MHz, [D6]DMSO, TMS) δ/ppm
= 165.9, 146.7, 144.5, 133.1, 132.9, 123.0, 46.0; IR: ν/cm-1 = 3125, 3082, 2832, 2452, 1681, 1667,
1582, 1474, 1412, 1316, 1261, 1214, 1172, 1131, 1052, 1018, 874, 849, 816, 765, 704, 592
Anion exchange reactions
Ion exchange resin
3-methyl-benzo[1.2.3]thiadiazolium-7-carbothioic acid, S-methyl ester chloride,
[BTHMe][Cl], (5)
In a round-bottom flask of ion exchange resin Lewait MonoPlus SP-112 (0.8 g) was regenerated at
room temperature using of 10% NaCl solution (3 ml). Then the solution was separated from the
resin and the resin was washed five times with distilled water (3 ml) until no chloride anions were
detected. In order to verify that all the chloride ions were absorbed on the resin test with an aqueous
solution of 1% AgNO3 was performed. No precipitate after adding AgNO3 solution meant that
chloride ions in washed water were not present. To the regenerated resin, an aqueous solution of
[BTHMe][MeSO4] (2) (165 mg, 4.9 x 10-4 mol [BTHMe][MeSO4], 3 ml) was added and stirred for
half an hour at 50°C. Slow discoloration of the solution was observed. After this time, the solution
S14
was separated off and the resin was washed once with distilled water. Then NaCl (3 g) was added
into water (3 ml) and such solution was added to resin and stirred for 10 minutes. After this time,
the solution was separated and NaCl (1 g) in water (3 ml) was added again to the resin. After 10
minutes and separating water phase NaCl solutions were combined and evaporated. Next in order
to separate product from NaCl dry acetone (5 ml) was added and intensively stirred causing NaCl
to precipitate. Afterwards acetone phase was separated and evaporated. To purify obtained product,
methanol (5 ml) was added to dissolve product and to separate any remaining solid residues. In the
last step, solvent was evaporated yielding product. Obtaining of the product was confirmed by
NMR where disappearance of the peak of the anion [MeSO4]- was indicative of the reaction
completion.
m.p. 124.9oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.2 (1 H, d, C(6)H),
8.9 (1 H, t, C(6)H), 8.4 (1 H, d, C(6)H), 5.0 (3 H, s, NMe), 2.7 (3 H, s, SMe), 13C NMR (75 MHz,
[D6]DMSO, TMS) δ/ppm = 190.6, 147.4, 133.9, 130.3, 129.8, 124.5, 42.16, 12.2; IR: ν/cm-1 =
3071, 2991, 2949, 2924, 1628, 1586, 1449, 1327, 1245, 1201, 1119, 1069, 997, 843, 798, 751
Extraction method
3-methyl-benzo[1.2.3]thiadiazolium-7-carboxylic acid docusate, [BTHCOOH(Me)][Doc],
(16)
[BTHCOOH(Me)][MeSO4] (13) (1g, 3.27 x 10-3 mol) was dissolved in water in a beaker.
Meanwhile) of sodium docusate (1.23 g, 2.8 x 10-3 mol, 0.85 molar eq) was dissolved in water in
another beaker. Sodium docusate is used in the reaction in the deficiency in respect to
[BTHCOOH(Me)][MeSO4] due to easier later separation of product (dissolved in organic phase)
from the excess [BTHCOOH(Me)][MeSO4] (well soluble in water). After accurately stirring two
S15
mixtures, the solution of sodium docusate was added to the solution of [BTHCOOH(Me)][MeSO4]
and such solution was placed in separation funnel. After that, dichloromethane (10 ml) was added
and two-phase system was shaken vigorously. After phases separation, dichloromethane (DCM)
phase was separated. The organic phase was washed two times with water in order to remove
[Na][MeSO4] and possible unreacted substrate [BTHCOOH(Me])[MeSO4]. Next DCM phase was
evaporated to obtain brown-yellow oil which was also washed two times with water and one time
with hexane due to the fact that [Na][Doc] is well soluble in hexane and water. The structure of
obtained product [BTHCOOH(Me)][Doc] (3-methyl-benzo[1.2.3]thiadiazolium 7-carboxylic acid
docusate) was confirmed by NMR. In the IR spectrum peaks from both ions were identified. Also
the disappearance of the peak from the anion [MeSO4]- was observed in the NMR. Yield: 90%,
dark yellow, low melting wax, no clear melting point.
m.p. no clear m.p.; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.1 (1 H, d, C(6)H),
8.6 (1 H, t, C(6)H), 8.3 (1 H, d, C(6)H), 5.0; (3 H, s, NMe), 3.9 (2 H, d, CHO), 3.6 (2 H, d, CHO),
3.3 (1 H, t, CHSO3), 2.9 (2 H, d, CH), 2.8 (3 H, s, SMe), 1.3-1.5 (16 H, m, alkyl), 0.8-0.9 (12 H,
m, alkyl); 13C NMR (75 MHz, [D6]DMSO, TMS) δ/ppm = 171.0, 168.6, 166.0, 146.7, 144.5, 133.1,
132.9, 123.5, 66.1, 63.0, 46.1, 41.4, 34.3, 29.8, 29.7, 29.6, 28.6, 28.3, 23.0, 22.6, 22.4, 22.3, 13.9,
13.8, 10.8, 10.7; IR: ν/cm-1 = 3462, 2958, 2930, 2860, 1731, 1687, 1586, 1460, 1413, 1380, 1329,
1222, 1157, 1034, 898, 850, 798, 762, 709, 600.
3-methyl-benzo[1.2.3]thiadiazolium-7-carbothioc acid, S – methyl ester dodecyl sulfate,
[BTHMe][LS], (9)
[BTHMe][MeSO4] (2) (1 g, 4.76 x 10-3 mol) and sodium lauryl sulfate (1.38 g, 4.76 x 10-3 mol)
were dissolved in water in separate vessels. After accurately stirring, and combining into one
S16
solution, water was evaporated. After drying on high vacuum, methanol (5 ml) was added.
Immediately white precipitate (identified on IR as inorganic byproduct) was observed and
separated. Methanol phase was evaporated and white powder was obtained. The IR spectrum
proved presence of the peaks from two substrate ions. In the NMR spectra the disappearance of the
peak from the anion [MeSO4]- was observed indicating obtaining of the product. Product 3-methyl-
benzo[1.2.3]thiadiazolium 7-carbothioc acid, S – methyl ester lauryl sulfate was obtained as white
powder. Yield of reaction: 65%
m.p. 103.6oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.2 (1 H, d, C(6)H),
8.9 (1 H, t, C(6)H), 8.4 (1 H, d, C(6)H), 5.0 (3 H, s, NMe), 3.7 (2 H, t, CHSO3), 2.7 (3 H, s, SMe),
1.4 (2 H, t, CH), 1.2 (18 H, m, alkyl), 0.8 (3 H, t, Me); 13C NMR (75 MHz, [D6]DMSO, TMS)
δ/ppm = 190.3, 147.0, 141.2, 133.3, 131.7, 129.2, 123.9, 65.4, 60.7, 46.1, 32.5, 31.3, 29.0, 28.9,
25.5, 22.0, 13.9, 11.7; IR: ν/cm-1 = 3079, 2954, 2920, 2850, 1625, 1586, 1248, 1216, 1199, 1152,
1077, 1055, 968, 834, 751.
3-methyl-benzo[1.2.3]thiadiazolium-7-carboxylic acid bis(trifluoromethanesulfon)imide,
[BTHCOOH(Me)][NTf2], (15)
[BTHCOOH(Me)][MeSO4] (13) (1 g, 3.27 x 10-3 mol) was dissolved in water (1 ml) in test-tube.
When all of the substrate was completely dissolved in water solution of
bis(trifluoromethanesulfon)imide lithium salt (LiNTf2, 80% solution in water) (0.8 g, 2.8 x 10-
3mol, 0.85 molar eq) was added. The solution was evaporated and methanol was added. White,
inorganic powder ([Li][MeSO4]) was obtained and filtrated from the solution. The methanol
solution was evaporated. Product 3-methyl-benzo[1.2.3]thiadiazolium 7-carboxylic acid
bis(trifluoromethanesulfon)imide was obtained as white powder with yield 58%.
S17
m.p. 205.9oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.2 (1 H, d, C(6)H),
8.9 (1 H, t, C(6)H), 8.4 (1 H, d, C(6)H), 5.0 (3 H, s, NMe); 13C NMR (75 MHz, [D6]DMSO, TMS)
δ/ppm = 165.4, 145.9, 145.0, 132.9, 131.5, 123.6, 121.2, 120.7, 118.2, 45.8; IR: ν/cm-1 = 3085,
1702, 1588, 1438, 1322, 1317, 1188, 1140, 1077, 1051, 934, 831, 798, 468, 740, 712, 609, 567,
512.
Precipitation method
3-methyl-benzo[1.2.3]thiadiazolium--7-carbothioic acid, S-methyl ester 2-(N-
morpholino)ethanesulfonate, [BTHMe][MES], (8)
[BTHMe][MeSO4] (2) (1 g, 4.76 x 10-3 mol) and 2-(N-morpholino)ethanesulfonate sodium salt
([Na][MES]) (1.04 g, 4.76 x 10-3 mol) were dissolved in water. After accurately stirring, and
combining into one solution, water was evaporated. After drying on high vacuum, methanol (1 ml)
was added. Immediately formation of white precipitate (identified on IR as inorganic byproduct
[Na][MeSO4]) was observed. Precipitate was separated and then methanol phase was evaporated.
White powder was obtained. The IR spectrum allowed to identify peaks from both of substrate
ions. In the NMR spectra the disappearance of the peak of the anion [MeSO4]- was observed.
Product 2-(N-morpholino)ethanesulfonic acid 3-methyl-benzo[1.2.3]thiadiazolium 7-carbothioc
acid salt as yellow powder was obtained. Yield of reaction: 65%
m.p. 131.4oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.2 (1 H, d, C(6)H), 8.8 (1
H, t, C(6)H), 8.4 (1 H, d, C(6)H), 5.0 (3 H, s, NMe), 3.4 (4 H, t, OCH), 3.1 (4 H, t, NCH), 2.9 (2
H, t, CHSO3), 2.9 (2 H, t, NMe), 2.7 (3 H, s, SMe); 13C NMR (75 MHz, [D6]DMSO, TMS) δ/ppm
= 191.1, 147.1, 141.2, 133.3, 131.7, 129.2, 123.9, 63.4, 51.2, 46.1, 44.9, 11.7; IR: ν/cm-1 = 3062,
3028, 1625, 1583, 1442, 1262, 1242, 1166, 1121, 1080, 1062, 1037, 995, 977, 910, 846, 764, 545.
S18
3-methyl-benzo[1.2.3]thiadiazolium -7-carbothioic acid, S-methyl ester iodide, [BTHMe][I],
(3)
To round bottom flask [BTHMe][MeSO4] (2) (1 g, 4.76 x 10-3 mol) was dissolved in methanol (3
ml) and sodium iodide (0.714 g, 4.76 x 10-3 mol ) in methanol (10 ml) was added. After steering
overnight white crystals of [Na][MeSO4] precipitated and were than filtered. Crystal were
separated and methanol phase was collected and evaporated to obtain product as orange powder
with yield: 99%.
m.p. 112.9oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.2 (1 H, d, C(6)H), 8.9 (1
H, t, C(6)H), 8.4 (1 H, d, C(6)H), 5.0 (3 H, s, NMe), 2.7 (3 H, s, SMe); 13C NMR (75 MHz,
[D6]DMSO, TMS) δ/ppm = 192.0, 148.2, 142.6, 134.1, 132.7, 130.4, 124.7, 47.0, 12.8; IR: ν/cm-1
= 2981, 2917, 1620, 1508, 1572, 1479, 1439, 1329, 1252, 1199, 1085, 1068, 997, 878, 845, 797,
725, 701, 673.
3-methyl-benzo[1.2.3]thiadiazolium-7-carboxylic acid iodide, [BTHCOOH(Me)][I], (14)
[BTHCOOH(Me)][MeSO4] (13) (2 g, 6.5x10-3 mol) and (0.98 g, 6.5x10-3 mol) sodium iodide (NaI)
were each dissolved separately in dry methanol (5 ml). When substrates were completely dissolved
the solutions were mixed. Immediately, white powder precipitated. After filtration methanol phase
was evaporated and dried on vacuum pump. Orange powder of 3-methyl-benzo[1.2.3]thiadiazole-
3-ium-7-carboxylic acid iodide was obtained with yield: 90%.
m.p. 177.6oC; 1H NMR (300 MHz, [D6]DMSO, 25oC, TMS) δ/ppm = 9.1 (1 H, d, C(6)H), 8.6 (1
H, t, C(6)H), 8.4 (1 H, d, C(6)H), 5.0 (3 H, s, NMe); 13C NMR (75 MHz, [D6]DMSO, TMS) δ/ppm
S19
= 166.2, 147.1, 144.1, 133.1, 125.2, 122.9, 46.4; IR: ν/cm-1 = 3602, 3406, 3060, 1687, 1583, 1492,
1438, 1316, 1241, 1158, 1135, 1065, 1010, 899, 849, 756, 726, 696, 616, 602, 593.
Antibacterial activity tests
Microorganisms used in this studies were: Staphylococcus aureus ATCC 6538, Escherichia coli
ATCC 25922, Pectobacterium carotovorum ATCC 15713, and Pseudomonas syringae ATCC
19508. Strains were supplied by American Type Culture Collection (ATCC)
The antibacterial activity was determined using the dilution method.[E4] Bacteria strains were
cultured on a Mueller-Hinton broth for 24 h. A suspension of the bacteria at a concentration of 106
cfu/cm-3 (cfu = colony forming units), was prepared from each culture. Then each dilution of the
tested salt was inoculated with a broth medium suspension, as described above, in a 1:1 ratio.
Additionally one concentration in 2:1 ratio (salt: culture broth medium suspension) was made and
tested. Growth of (or the lack of) the microorganisms was determined visually after incubation for
24 h at 37ºC for S. aureus and E. coli, and in 27ºC for P. carotovorum and P. syringae. The lowest
concentration of tested substances at which there was no visible growth (turbidity) was taken as
the MIC (Minimal Inhibitory Concentration). Then, an aliquot taken from each tube in a sample
loop was cultured in an agar medium with inactivates (0.3% lecithin, 3% polysorbate 80 and
0.1% ysteine L) and incubated for 48 h at the temperatures mentioned above. The lowest
concentration of the salt supporting no colony formation was defined as the MBC (Minimum
Bactericidal Concentration). Studies were conducted on four strains of bacteria. Due to a
phytotoxic effect of the tested salts, its highest concentration tested was also concluded as the
highest non phytotoxic concentration. That is why in some cases it was not possible to define both
MIC and the MBC values.
S20
Phytotoxicity test
The N. tabacum var Xanthi plants were watered with water solutions (50 ml) containing active
substance in concentration of 20 mg/l (0.36 mg/l for [BTHMe][NTf2] (6); 12.6 mg/l for
[BTHCOOH(Me)][NTf2] (15)). Several days after treatment visual effects of used compounds on
the plants were analyzed. The symptoms of phytotoxicity were observed as necrotic spots,
yellowing of part or all leaves, retarded leaf growth, or general plant growth inhibition.
Direct influence of BTH derivatives on the virus infectivity
To assess direct impact of tested BTH derivatives on the infectivity of virus particles, compounds
were dissolved in water at concentration: 50 mg/l or in 5% aqueous methanol solution in case of
([BTHMe][NTf2] (6) and [BTHCOOH(Me)(NTf2)] (15) at concentrations 0.9 mg/l and 31.5 mg/l
respectively. Initially, the tobacco mosaic virus (TMV) was incubated for about 30 minutes in
solution of BTH derivatives, and then N. tabacum var. Xanthi leaves were mechanically infected.
In the control, tobacco leaves were infected with a mixture of TMV virus which was previously
incubated only in distilled water. After 4 days post the infection the necrotic spots on tobacco plant
infected with virus from control and treated before in BTH and BTHCOOH derivatives solution
were counted and compared.
SAR induction activity
In the following experiment, plants of N. tabacum var Xanthi, at the stage of three-developed
leaves, were watered with 50 ml solutions of salts in water in concentration: 20 mg/l (except for
([BTHMe][NTf2] (6) and [BTHCOOH(Me)(NTf2)] (15) at concentrations 0.9 mg/l and 31.5 mg/l
respectively) and the control with distilled water that was used for the preparation of solutions of
S21
salts. Seven days later, the treated leaves were infected mechanically with Tobacco mosaic virus.
After the next 4-5 days a local necrotic spots, as a result of a viral infection, were counted and
compared between the number of spots on the leaves treated with salt and distilled water (control).
Reduction in the number of necrotic spots on the leaves treated with salt, in comparison with the
control, shows inhibition of viral infection by induction of plant resistance through the use of salts.
Moreover, aside from the reduction in the number of local necrotic spots, in tobacco plants treated
with salts reduction in the size of local necrotic spots formed on leaves was observed.
RNA isolation and cDNA synthesis
Total RNA was extracted from collected plant material [N. tabacum] i) treated with BTH (1), ii)
treated with cationic derivative of [BTHMe][Doc] (7), and iii) treated only with water, using TRI-
Reagent (ThermoFisher Scientific, Waltham, MA) according to manufacturer’s instruction. The
pellet of total RNA was dissolved in 20-40 μl of RNase-free water, quantified by
spectrophotometry, and stored at -70°C. Reverse transcription (RT) was performed using
RevertAid First Strand cDNA Synthesis Kit (ThermoFisher). In this aim, 1μg of total RNA was
combined with 200 ng of random hexamer primers and incubated at 65°C for 5 min, then the
mixture was cooled on ice and 4 µl of 5x Reaction Buffer, 2 µl of 10 mM dNTPs, 20 U/μl RiboLock
RNase Inhibitor and 200 U/μl of RevertAid M-MuLV Reverse Transcriptase (Thermo Scientific)
were added. The reaction was carried out in a total volume of 20 μl following the thermal profile:
25°C for 10 min, 60 min at 42°C, and terminated by heating at 70°C for 5 min. The obtained cDNA
samples were used as template for real-time PCR reactions.
S22
Real-time PCR
The effectiveness of treatments with BTH (1) and analyzed cationic derivative [BTHMe][Doc]
(7) on the expression levels of defense related genes - PR1a and PAL in relation to control (plants–
treated only with water) was determined by real-time PCR approach. The PR-1 gene was amplified
with specific primers designed previously.[E5] PR-1F 5′-
CATAACACAGCTCGTGCAGATGTAG-3′ and PR-1R 5′-
AACCACCTGAGTATAGTGTCCACAC-3′, the gene of defense-related PAL enzyme was
amplified with primers palF 5’AGAGGATCCGTTTCGTGAAG 3′, palR
5′TGAGGCTGCTGCTATTATGG 3′ ).[E6] For normalization, the level of the N. tabacum EF1a
gene transcription was used as a reference. For the EF1a amplification following specific primers
were used: EF1aF 5′ TGTGATGTTTTTGTTCGGTCTTTAA 3′, EF1R 5′
TCAAAAGAAAATGCAGACAGACTCA 3′.[E7] The real-time PCR reaction was carried out in
a Roche LightCycler 480 Real-Time PCR System and universal ‘‘FAST’’ cycling conditions,
which were as follows: for EF1a gene amplification (5 min 95˚C, 40 cycles of 15 s at 95˚C and 60
s at 60˚C) and for PR1a and PAL genes (5 min 95˚C, 40 cycles of 15 s at 95˚C, 20 s at 58˚C and
20 s at 72˚C) followed by the generation of a dissociation curve to determine the accuracy of the
reaction. The reaction contained 1x iTaq™ universal SYBR Green supermix (Biorad) with primers
at a final concentration of 0.5 μM each, 1 μl of cDNA obtained in the previous step, and water up
to 10μl of total volume. All reactions were performed for four biological replicates in each
conditions. An analysis and interpretation of the results was carried out using Relative Expression
Software Tool V2.0.13 (Qiagen) based on the ΔΔCt method.[E8]
S23
References for supplementary information
[E1] Lewandowski, P.; Kukawka, R.; Smiglak, M.; Pospieszny, H. Bifunctional quaternary
ammonium salts based on benzo[1,2,3]thiadiazole-7-carboxylate as plant systemic
acquired resistance inducers, New J. Chem. 2014, 38, 1372-1375.
[E2] Smiglak, M.; Kukawka, R.; Lewandowski, P.; Pospieszny, H. Cationic derivatives of the
plant resistance inducer benzo[1,2,3]thiadiazole-7-carbothioic acid S-methyl ester (BTH)
as bifunctional ionic liquids, Tetrahedron Lett. 2014, 55, 3565-3568.
[E3] OECD Paris, Partition Coefficient, 1981, Test Guideline 107, Decision of the Council
C(81) 30 final.
[E4] Cieniecka-Rosłonkiewicz, A.; Pernak, J.; Kubis-Feder, J.; Ramani, A.; Robertson, A.
Seddon, R. Synthesis, anti-microbial activities and anti-electrostatic properties of
phosphonium-based ionic liquids, Green Chem. 2005, 7, 855-862.
[E5] Kulye, M.; Liu, H.; Zhang, Y.; Zeng, H.; Yang, X.; Qiu, D. Hrip1, a novel protein elicitor
from necrotrophic fungus, Alternaria tenuissima, elicits cell death, expression of defence-
related genes and systemic acquired resistance in tobacco, Plant Cell Environ. 2002, 35,
2104–2120.
[E6] Chang, Y. H.; Yan, H. Z.; Liou, R. F. A novel elicitor protein from Phytophthora parasitica
induces plant basal immunity and systemic acquired resistance, Mol. Plant Pathol. 2015,
16, 123-136.
[E7] Lochman, J.; Mikes, V. Ergosterol treatment leads to the expression of a specific set of
defence-related genes in tobacco, Plant Mol. Biol. 2006, 62, 43–51.
S24
[E8] Pfaffl, M. W.; Horgan, G. W.; Dempfle, L. Relative expression software tool (REST©) for
group-wise comparison and statistical analysis of relative expression results in real-time
PCR, Nucleic Acids Res., 2002, 30, e36-e36.
Top Related