Polish Journal of Microbiology · \pjm\ at PTM Journals online Visit the home page to browse...

$: Polish Journal of Microbiology · \pjm\ at PTM Journals online Visit the home page to browse contents, gallery, links page and instructions to authors in HTML and PDF formats Editorial$
P O L S K I E T O W A R Z Y S T W O M I K R O B I O L O G Ó WP O L I S H S O C I E T Y O F M I C R O B I O L O G I S T S

Polish Journal of Microbiology

formerly

Acta Microbiologica Polonica

2006

POLSKIE TOWARZYSTWO MIKROBIOLOGÓW

EDITORS

Miros³awa W³odarczyk (Editor in Chief)

Jaros³aw Dziadek, Anna Kraczkiewicz-Dowjat, Anna Skorupska, Hanna DahmEl¿bieta Katarzyna Jagusztyn-Krynicka (Scientific Secretary)

EDITORIAL BOARD

President: Zdzis³aw Markiewicz (Warsaw, Poland)

Katarzyna Brzostek (Warsaw, Poland), Ryszard Chróst (Warsaw, Poland), Waleria Hryniewicz (Warsaw, Poland),Miros³aw Kañtoch (Warsaw, Poland), Donovan Kelly (Warwick, UK), Tadeusz Lachowicz (Wroc³aw, Poland),Wanda Ma³ek (Lublin, Poland), Andrzej Piekarowicz (Warsaw, Poland), Anna Podhajska (Gdañsk, Poland) ,Gerhard Pulverer (Cologne, Germany), Geoffrey Schild (Potters, Bar, UK), Torkel Wadström (Lund, Sweden),

Jadwiga Wild (Madison, USA)

EDITORIAL OFFICE

Miecznikowa 1, 02-096 Warsaw, Polandtel. 48 (22) 55 41 318, fax 48 (22) 55 41 402

e-mail [email protected]

Archives of Acta Microbiologica Polonica, from 2004 Polish Journal of Microbiology online

www.microbiology.pl\pjm\ at PTM Journals online www.microbiology.pl

Visit the home page to browse contents, gallery, links page and instructions to authorsin HTML and PDF formats

Editorial correspondence should be addressed to Editors of Polish Journal of Microbiology02-096 Warsaw, Miecznikowa 1, Poland

Correspondence regarding subscription and spedition of Polish Journal of Microbiology should be addressed toNational Institute of Public Health, Division of Clinical Microbiology and Prevention of Infections

00-725 Warsaw, Che³mska 30/34tel. 48 (22) 841 33 67, fax 48 (22) 841 29 49, e-mail: [email protected]

QUARTERLY OF POLISH SOCIETY OF MICROBIOLOGISTS,PUBLISHED WITH THE FINANCIAL SUPORT

OF THE MINISTRY OF EDUCATION AND SCIENCE

The Ministry of Education and Science has credited Polish Journal of Microbiology with 10 pointsThe Polish Journal of Microbiology is on the Thomson Scientific Master List

POLISH SOCIETY OF MICROBIOLOGISTS00-725 Warsaw, Che³mska 30/34

Front cover: Colonies of bacteria with nitrifying activity isolated from landfill leachate(courtesy of Renata Matlakowska Ph.D.)

Typesetting and print: Publishing House Letter QualityWarsaw, Brylowska 35/38, tel. 0 22 631 45 18, 0 607 217 879

Circulation: 300 + 15

CONTENTS

IN MEMORIAM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83

ORIGINAL PAPERS

Genetic characterisation of the cjaAB operon of Campylobacter coliWYSZYÑSKA A., PAW£OWSKI M., BUJNICKI J., PAWELEC D., van PUTTEN J.P.M., BRZUSZKIEWICZ E.,JAGUSZTYN-KRYNICKA E.K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85

Natural mannose-binding lectin (MBL) down regulates phagocytosis of Helicobacter pyloriSTRAPAGIEL D., GRÊBOWSKA A., RÓ¯ALSKA B., B¥K-ROMANISZYN L., CZKWIANIANC E.,P£ANETA-MA£ECKA I., RECHCIÑSKI T., RUDNICKA W., CHMIELA M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

Phenotypic and genotypic characteristic of Pseudomonas aeruginosa strains isolated from hospitals in the north-west

region of PolandCZEKAJ£O-KO£ODZIEJ U., GIEDRYS-KALEMBA S., MÊDRALA D. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103

Detection of enterotoxic Bacillus cereus producing hemolytic and non hemotylic enterotoxins by PCR testO£TUSZAK-WALCZAK E., WALCZAK P., MODRAK R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113

Optimization and purification of alkaline proteases produced by marine Bacillus sp. MIG newly isolated from EasternHarbour of AlexandriaM.K. GOUDA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119

Novel yeast cell dehydrogenase activity assay in situBER£OWSKA J., KRÊGIEL D., KLIMEK L., ORZESZYNA B., AMBROZIAK W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127

In vitro activity of caspofungin against planktonic and sessile Candida sp. cellsSEREFKO A., CHUDZIK B., MALM A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133

Enhancement of oil degradation by co-culture of hydrocarbon degrading and biosurfactant producing bacteriaKUMAR M., LEON V., De SISTO MATERANO A., ILZINS O.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139

Biotranformation of phosphogypsum on distillery decoctions (preliminary results)WOLICKA D., KOWALSKI W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147

Survival of Proteus mirabilis O3 (S1959), O9 and O18 strains in normal human serum (NHS) correlates with the diversityof their outer membrane proteins (OMPs)FUTOMA-KO£OCH B., BUGLA-P£OSKOÑSKA G., DOROSZKIEWICZ W., KACA W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153

Lack of an association between Helicobacter infection and autoimmune hepatitis in childrenDZIER¯ANOWSKA-FANGRAT K., NILSSON I., WO�NIAK M., JÓ�WIAK P., RO¯YNEK., WOYNAROWSKI M.,SOCHA J., LJUNGH A., WADSTROM T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157

INSTRUCTIONS TO AUTHORS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161

Polish Journal of Microbiologyformerly Acta Microbiologica Polonica

2006, Vol. 55, No 2

Polish Journal of Microbiology2006, Vol. 55, No 2, 83�84

The fields of Molecular Biology and Biotechnology have lostthe World-famous Polish microbiologist, Professor Anna JagodaPodhajska. She was the Founder and former Associate Dean of theIntercollegiate Faculty of Biotechnology at the University of Gdañskand Medical University of Gdañsk and also the Chair of the De-partment of Biotechnology within this Faculty. She was 68 yearsold and fell victim to a brain cancer.

Anna Podhajska was born on 17 April 1938 in Gdynia and herchildhood coincided with the horrors of Nazi occupation of Poland(including a Concentration Camp). She graduated from the Medi-cal University of Gdañsk in 1964 and received there her Ph.D. inmicrobiology in 1968. This was followed by a habilitation in 1987,based on her work on class IIS restriction endonucleases.

From 1969 Anna Podhajska was working with Professor KarolTaylor (Gene, 223 (1998) 393�394) at Department of Biochemis-try at the University of Gdañsk, and then organized and chairedDepartment of Microbiology at the same School. For 3 years start-ing in 1981 and then for several months each year she spend about10 years at Wac³aw Szybalski laboratory at the MaArdle Labora-tory for Cancer Research, University of Wisconsin-Madison.

Among her major discoveries, Anna described the universalrestriction endonucleases able to cleave DNA at any predeterminedsite. These were constructed of an oligo-adapters and class-IISrestriction enzymes. This work was done in the Wac³aw Szybalskilaboratory at the University Wisconsin-Madison. Her work was published in Science (1988, 240:504�506)and Methods in Enzymology (1992, 216:303�309) and then was selected to be cited or reprinted in severalbooks and scientific journals.

After her return to Gdañsk, in 1992 and inspired by the Madison experience, Anna began to plan andorganize the Intercollegiate Faculty of Biotechnology University of Gdañsk and Medical University of Gdañsk,and became its first Associate Dean from 1993 until 1997.

Her more recent research was concentrated on several topics: (1) Development and implementation ofmolecular diagnostics of human viral diseases (hepatitis B virus, hepatitis C virus, human immunodefi-ciency virus (HIV), cytomegalovirus human papillomavirus), (2) Emerging variants of hepatitis B virus:new tools epidemiological survey, diagnosis of infection, and monitoring of drug resistance, (3) Moleculardiagnostics of cancer diseases (breast cancer and cervical cancer), (4) Molecular studies on new photosensi-tizers as applied to photodynamic method of cancer diagnostics and treatment, (5) Application of new mo-lecular markers to study the diversity of cyanobacteria and identification of toxic strains of cyanobacteria,(6) Human and bacterial gene cloning and protein purification for scientific and commercial application

Anna was elected as a member of The Committee of Biotechnology and The Committee of Microbiology,Polish Academy of Sciences (PAN). She was also a member of several Scientific Boards, including those ofThe Institute of Marine and Tropical Medicine in Gdynia, The Institute of Sera and Vaccines in Warsaw,The Centre for Microbiology and Virology PAN in £od�, PAN Library in Gdañsk and of The Editorial

IN MEMORIAM

Anna Jagoda Podhajska (1938 � 2006)

84 In Memoriam 2

Boards of several scientific journals (Gene, Polish Journal of Microbiology, Polish Journal of Cosmeto-logy). She was elected by the assembly of the Scandinavian and Baltic Universities, Clinics and Companiesas a Vice-President of ScanBalt association in 2002 (Borderless Biotech: Europe�s First Meta-Region TakingShape, Euro Biotech News 2003, 3:22�25).

Anna was a very kind woman, always ready to help, true academic teacher with an outstanding sense ofhumor. She was an excellent experimenter, teacher and also proficient organizer who built modern Intercolle-giate Faculty of Biotechnology. Moreover, she has initiated The Biotechnology Summer School, organizedby Faculty every year since 1994.

Anna was a worldwide-known Polish scientist, in the fields of restriction endonucleases and later inmolecular diagnostics and epidemiology of hepatitis virus B and C, and in Poland, in establishing biotechno-logy at both University of Gdañsk and Medical University of Gdañsk and training a new generation ofPolish molecular biologists. She was also an excellent organizer of technology transfer from the universitylaboratory to the biotechnological companies. She had planned and established Center of Technology Transferin Gdañsk and initiated the Pomeranian Science and Technology Park in Gdynia.

Anna was also one of initiators and Chair of the Jury (from 2001 to 2006) of the Polish edition of theL�Oreal and UNESCO award �For Women in Science� known as �L�OREAL Polska dla Kobiet i Nauki�.

Anna Podhajska and her genius are irreplaceable. She was an exceptional person and her educationalskills, organizational energy, and recently, her participation in establishment of the Scandinavian and Balticcountry network (ScanBalt) will be always missed very much.

Ewa £ojkowska


Genetic Characterisation of the cjaAB Operon of Campylobacter coli

AGNIESZKA WYSZYÑSKAa, MARCIN PAW£OWSKIb, JANUSZ BUJNICKIb,DARIUSZ PAWELECa,e, JOS P. M. VAN PUTTEN, EL¯BIETA BRZUSZKIEWICZa,d

and EL¯BIETA K. JAGUSZTYN-KRYNICKAa,*

a Department of Bacterial Genetics, Institute of Microbiology, Warsaw University,02-096 Warsaw, Miecznikowa 1, Poland;

b Laboratory of Bioinformatics, International Institute of Molecular and Cell Biology in Warsaw,Trojdena 4, 02-109 Warsaw, Poland;

c Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine,Utrecht University, Utrecht, The Netherlands;

d Current address: University of Göttingen, Institute of Microbiology and Genetics, Germany;e Current address: Adamed Sp z o.o., Pienków 149, 05-152 Czosnów, Poland

Received 6 January 2006, revised 30 January 2006, accepted 1 February 2006

A b s t r a c t

We investigated the regulation of the cjaA and cjaB genes of Campylobacter coli. These genes are seemingly arrangedinto one operon but appear to encode functionally different proteins i.e. an extracytoplasmic solute receptor and a MHS� metabolite: H+ symporter transport protein. Analysis of various transcriptional cjaA and/or cjaB lacZ fusion con-structs revealed that both genes are arranged in an operon. RACE analysis located the transcription start site of thecjaAB operon 46 bp upstream of the translation start point. $-galactosidase reporter assays yielded much higher activityfor the cjaA than the cjaB gene fusion products. RT-PCR showed unequal amounts of mRNA, indicating differentialpost-transcriptional processing of cjaA and cjaB mRNA possibly related to the presence of inverted repeats in theintergenic region. Phylogenetic analysis grouped CjaB into a new MHS sub-family together with potential transporterswith uncharacterised functions of Campylobacter and Helicobacter. Notably, no CjaB family members were identifiedin g-Proteobacteria from different ecological niches, such as H. hepaticus and Wolinella succinogenes.

K e y w o r d s: Campylobacter, cjaAB operon, gene expression, phylogenetic analysis

Introduction

The Gram-negative bacteria Campylobacter coli and Campylobacter jejuni are commensal bacteria ofwarm-blooded animals and a major cause of human enteritis all over the world (Coker et al., 2002). Among thesequenced bacterial genomes, that of C. jejuni is one of the most compact one; 94.3% of the genome is occu-pied by protein-coding regions. Most of C. jejuni genes are possibly expressed as polycistronic operons asjudged from the genome organisation (Parkhill et al., 2000). In contrast to many prokaryotic genomes, themajority of C. jejuni genes are not functionally grouped. This fact might suggest separate transcription of themajority of Campylobacter genes. On the other hand, short intergenic DNA fragments present in the genomeand the high number of overlapping genes (more than 26% of all of the genes) rather contradicts this hypo-thesis (Meinersmann and Wassenaar, 2003). Such an untypical genome organisation is also an attribute of thegenome of Aquifex aeolicus, a thermophilic, chemolithoautotrophic bacterium (Deckert et al., 1998) andmethanogenic archaeon Methanococcus jannaschii (Bult et al., 1996). This unusual organisation of the geneticmaterial raises an important question concerning the regulation of gene expression at the transcriptional level.

Campylobacter, with a medium genome size of 1.64 Mb, like the closely related Helicobacter, containsthree sigma factors, F28, F54 and F70 encoded by fliA, rpoN and rpoD genes, respectively (Parkhill et al.,2000; Tomb et al., 1997). The hitherto characterised Campylobacter promoters are unusual compared to

* Corresponding author: E.K. Jagusztyn-Krynicka, Department of Bacterial Genetics, Institute of Microbiology, Warsaw Uni-versity, 02-096 Warsaw, Miecznikowa 1, Poland; Phone (48) 22-5541216; Fax (48) 22-5541402; 35; e-mail: [email protected]

86 Wyszyñska A. et al. 2

other bacteria. They have two consensus sequences TATAATT and TTTTTTG located in �10 and �16 regionsbut appear to lack a conserved �35 motif. The absence of a �35 region seems to be compensated bya specific periodic signal located upstream of the �16 region (Petersen et al., 2003; Wosten et al., 1998).

The present study was designed to learn more about the regulation of Campylobacter cjaA and the down-stream cjaB gene expression. These genes are separated by a 41 nucleotides long DNA fragment and encodeproteins that belong to different transporter superfamilies. CjaA encodes a putative amino acid bindingprotein of the ABC (ATP-binding cassette) transport system, while CjaB encodes a putative integral mem-brane protein of the MFS (major facilitator superfamily) family six (MHS � metabolite: H+ symporter).Preliminary sequence analysis suggested that the genes may be located in an operon. In the present work,we further investigated the regulation of the cjaA and cjaB genes. Since CjaA is highly immunogenic pro-tective Campylobacter antigen the better understanding of the cjaA gene expression is crucial for elucida-tion its role in pathogenesis and may facilitate its use as a vaccine component.

Experimental

Materials and Methods

Bacterial strains, plasmids, media and growth conditions. Bacterial strains and plasmids used in this work are listed inTable I. C. coli 72Dz/92 (Lior 71) was cultured as described earlier (Pawelec et al., 1997). Minimal essential medium (MEM) fromGibcoBRL was used as a defined minimal medium. E. coli strains were grown in LB medium at 37°C. Antibiotics: ampicillin(50 µg ml�1), kanamycin (40 µg ml�1) chloramphenicol (20 mg µl�1), were added to the media when appropriate.

Bacterial strains

E. coli XL1-Blue recA1 endA1 gyrA96 thi1 hsdR17 supE4 Stratagene4 relA1lac [F� proAB lacIqZ )M15 Tn10 (tetr)]

E. coli DH5" recA1 endA1 gyrA96 thi-1 hsdR17 (rK

� mK

+) supE44 )lacU169 F� Institute of Microbiology, Warsaw(M80dlacZM15) University, Poland

E. coli WG350 F� trp rpsL thi )(putPA)101 )(proP mel)212 Culham et al., 1993

C. coli 72Dz/92 serotype Lior 71, biotype 1 Child Health Centre, Warsaw, Poland

C. jejuni 81176 Lior 5; isolated in Canada from a child with a bloody diarrhoea M. Blaser UV, Nashville, USA

C. coli AW4 C. coli 72Dz/92 cjaB::KanR This study

Plasmids

pBluescript II KS Apr, LacZ" Stratagene

pBluescript II SK Apr, LacZ" Stratagene

pBGS18 Kmr, LacZ" (Spratt et al., 1986)

pGEM-T TA cloning vector, Apr Promega

pBF14 Kmr University of Utrecht, The Netherlands

pMW10 Kmr (Wosten et al., 1998)

pUWM76 pBGS18 containing SalI-SspI 1.8 kb DNA fragment carrying cjaA (Pawelec et al., 1997)gene transcribed from own promoter

pUWM201 pBluescript II SK containing 5.8 kb EcoRV-EcoRV DNA fragmentcarrying cjaAB genes transcribed from the opposite DNA strand to lacZ (Pawelec et al., 1997)

pUWM272 pMW10 containing cjaA gene and 5� fragment of cjaB gene (545 bp) This study

pUWM273 pMW10 containing 3� fragment of cjaA gene (80 bp) and 5� fragment This studyof cjaB gene (545 bp)

pUWM472 pMW10 containing cjaA upstream region �591 to +34 This study

pUWM471 pMW10 containing 5� fragment of cjaA gene (679 bp) This study

pUWM477 pMW10 containing 5� fragment of cjaA gene (361 bp) This study

pUWM421 pGEM-T containing cjaB gene without 418 bp central region This study

pUWM422 KmR cassette of pBF14 cloned in the unique BamHI site This studyin pUWM421 in cjaB

Table IBacterial strains and plasmids used in this study

Relevant genotype or phenotype Source of reference

87Characterisation of cjaAB operon of C. coli2

DNA sequencing and analysis. The sequence of the cjaB gene was determined in the DNA Sequencing and OligonucleotidesSynthesis Laboratory, Institute of Biochemistry and Biophysics, Polish Academy of Sciences. The complete nucleotide sequenceof cjaB was submitted to the EMBL Nucleotide Sequence Database (accession number Y17971). The sequence of the cjaA gene isavailable in the EMBL under accession number Y10872.

DNA manipulation. DNA techniques including plasmid purification, ligation and transformation into E. coli were done accordingto standard procedures (Sambrook and Russell, 2001). Restriction endonucleases and DNA � modifying enzymes were obtainedfrom Promega and used according to the manufacturer�s instruction. Polymerase chain reactions (PCR) were performed with Taqpolymerase (Qiagen) in a Mastercycler Personal (Eppendorf). Oligonucleotide primers for PCR were from Sigma ARK (Table II).

Mutagenesis of cjaB gene. A cjaB mutant of C. coli 72Dz/92 was constructed by a two-step PCR and insertion of kanamycinresistance cassette (Km) derived from pBF14. First the 5� and 3� ends of cjaB were PCR amplified using the primer combinationsH1 and H5B, and CB1B and CB2. CB1B and H5B were designed with complementary protruding 5� tails with a BamHI restrictionsite. The obtained fragments of 432 and 447 bp were gel-purified, mixed and used as a template in a second PCR with the �outward�oriented primers H1 and CB2. The obtained PCR product that lacked the 418 bp central region of cjaB was cloned into the pGEM-Tcloning vector. The resulting plasmid pUWM421 (cjaB) was digested with BamHI and the BamHI-BamHI kanamycin cassette(aph) was inserted to obtain the final suicide plasmid pUWM422. Plasmid was introduced into Campylobacter by electroporation(with a Bio-Rad Gene Pulser set at 0.7 kV/cm, 25 µF and 600 S) and transformants were selected for kanamycin resistance. C. coli72Dz/92 with disrupted cjaB was designated AW4. The disruption of the cjaB gene was verified by PCR amplification.

Transcription and translation in vitro assay. The in vitro transcription and translation reaction was done with the E. coliExtraction System for Circular DNA kit (Promega).

Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Total RNA from C. coli containing pMW10 derivativeswas extracted using TRIzol Reagent (Molecular Research Center). RNA concentration was determined spectrophotometrically in10 mM of Tris-HCl, pH 7.2 at 260 nm as described (Sambrook and Russell, 2001). RNA preparations (1 µg of each sample) wererendered DNA free by incubation with RNase-free DNase (Roche). RT-PCR analysis was carried out by incubating equal amountsof total RNA first with reverse transcriptase (48°C, 45 min, followed by 2 min at 95°C) and then with Taq DNA polymerase. TheRNA used as a template in RT-PCR was reverse transcribed with the primer lacZ and the obtained cDNA was subsequently amplifiedwith primers lacZ1 and lacZ. PCR was performed with reagents purchased from Qiagen at the concentration recommended by thesupplier. The conditions for amplification were 20 cycles, each consisting of denaturation at 94°C for 1 min, annealing at 55°C for30 sec, and extension at 72°C for 30 sec. The amplified DNA fragments were analysed by 1.5% agarose gel electrophoresis.

$-galactosidase assay. $-galactosidase activity in C. coli and E. coli cell extracts was measured by the conversion of o-nitro-phenyl-$-D-galactopyranoside (ONPG) to nitrophenol as described by Miller (1972), with the modification that C. colitransformants were grown for 20 h on BA plates before being harvested in LB medium and diluted until the absorbance at 600 nmwas between 0.3�0.7. $-galactosidase activity assays were carried out in triplicate.

Rapid amplification of cDNA ends (RACE) analysis. To determine the start site of transcription the commercial �5� RACEsystem for rapid amplification of cDNA ends, version 2.0� (Gibco BRL, Life Technologies) was used according to themanufacturer�s directions. RACE analysis was carried out using the primers provided by the manufacturer and cjaA � specificprimers (327�3, AL, H3) indicated in Table II.

Primer sequencea (5� to 3�) Orientation

cjaA gene

H3 AcccgggatcgatggatccGAATCCACTTGCTCTGCTCTT Reverse

H1 GCTTATGATGAAACTTTAAAAAGTC Forward327�3 TTAACAGCAGGAGCAATTAC Reverse

AL ACTgaattcTATCTTGAGGCACAGCCA Reverse

cjaB gene

H5B AcccgggtagctaggatccgCTATACTCTCATAGCTTGGC Reverse

CB1B CggatcctagctacccgggTAACCAGCGGTGTAGCGACT Forward

CB2 GAGCAGCATCCTACCACCAT Reverse

lacZ gene

lacZ AGGTTACGTTGGTGTAGATG Reverse

lacZ1 GGAATTCACTGGCCGTCGTT Forward

aph gene

KmL1 GAGAATATCACCGGAATTGA Forward

KmR1 CTTCATACTCTTCCGAGCAA Reverse

Table IIOligonucleotides used in this study

a Capital bold letters indicate C. jejuni sequence, small letters � restriction recognition sequencesintroduced for cloning purposes


Database searches and sequence alignment. The amino-acid sequence of C. coli 72Dz/92 CjaB was used as a query inPSI-BLAST (Altschul et al., 1997) searches of the non-redundant database (NCBI, Bethesda, USA) to identify homologous pro-teins. Sequences reported with the expectation (e)-value above the threshold of 10�8 were downloaded and used to build the mul-tiple sequence alignments using ClustalX (Thompson et al., 1997).

Phylogenetic analysis. Phylogenetic inference was carried out using the conserved regions of the sequence alignment of CjaBhomologues based on the minimum-evolution method implemented in the Mega2 software package (Kumar et al., 2001). Thestability of all branches in the tree was validated using the interior branch test and the bootstrap method. The majority-rule consen-sus tree was visualised using Mega2.

Results

Transcription and translation in vitro assay. Examination of the nucleotide sequence downstream ofthe C. coli 72Dz/92 cjaA gene (orthologue of C. jejuni NCTC11168 cj0982c) revealed the presence of anopen reading frame designated cjaB. To study cjaB gene expression the plasmid pUWM201 was applied.It carries a 5.8 kb DNA fragment of C. coli 72Dz/92 including a 2.9 kb region located downstream of thecjaA gene (Pawelec et al., 1997). CjaA gene present in pUWM201 is transcribed in opposite orientationrelative to lacZ gene. The size of the proteins specified by pUWM201 was determined in an in vitro coupledtranscription-translation system. As shown in Fig. 1, pUWM201 encoded several proteins with molecularmasses of 18, 20, 30, 50 and 55 kDa that were not expressed from the parental vector pBluescript II SK.Based on the gene sizes, the 30 kDa proteins likely represented CjaA and $-lactamase. The 18 kDa proteincould be a truncated product of a gene located upstream of cjaA. The predicted amino acid sequence of thisprotein showed 46.9% identity to the C. jejuni JlpA (Cj0983) (Jin et al., 2001). This gene together withhipO is part of 15 kb DNA fragment that has been by now recognised as C. jejuni specific (Chan et al.,2000). Our results showed that there are Campylobacter strains containing, at least, part of this DNA regionand classified by PCR assays as C. coli. The remaining proteins were likely to be encoded by the DNAfragment downstream of cjaA. The sizes of the proteins were comparable to those predicted for the productsof C. jejuni NCTC11168 genes surrounding cj0982c, suggesting a similarity of the genetic organisationof the analysed region in the genomes of two clinical isolates of different species, C. coli and C. jejuni.The results obtained suggest that the majority, if not all, of the promoters located within this DNA regionwere active in E. coli.

Sequence analysis of cjaA downstream region. Sequencing of the DNA region downstream of cjaAyielded 1347 bp starting at the last position in the sequence previously obtained from pUWM76 carryingtruncated cjaB (Pawelec et al., 1997). The cjaB gene consists of 1248 nucleotides and carries an ATG (Met)start codon and TAA stop codon. Six nucleotides upstream of the proposed translation initiation codona putative ribosome binding site (AGGA) was observed. Downstream of cjaB an orthologue of cj0980 wasfound as deduced from the amino acid sequence of the C � terminus of the coding region. CjaB and the

Hin dIII

Hin dIII

cjaA cjaB

bla pUWM201

8,8 kb

Xba I

Xba I Eco RV

Eco RV

Sma I

A

Fig. 1. Analysis of proteins encoded by genes located within the C. jejuni DNA fragment cloned in pUWM201 by in vitro transcriptionand translation method.

The plasmid pUWM201 was isolated out of the overnight bacterial cultures of E. coli strain. The proteins were separated on 12% poliacrylamide gel,dried and exposed against Kodak X-OMAT AR film; a. pUWM201 restriction map, b. Autoradiogram: Lines: 1. pBluescript II KS, 2. pUWM201.

HindIII

EcoRVSmaIXbaI

HindIIIEcoRV

XbaI

1 2 kDa

5550

30 ($-lactamase CjaA)2018

B


downstream gene are convergently transcribed and overlap by 18 bp. Their orthologues from C. jejuniNCTC11168 (cj0980 and cj0981c) also overlap by 18 bp.

Comparison of the nucleotide sequence of the cjaB gene from C. coli 72Dz/92 with its orthologue fromC. jejuni NCTC11168 revealed 84% identity. Part of the C. jejuni 81176 cj0981c orthologue was sequenced(330 bp of the 5� end of the gene) and showed 100% identity with the corresponding fragment of theC. jejuni NCTC11168 cj0981c. The start codon ATG of cjaB is located 41 bp downstream of the cjaA stopcodon (TAA). Further inspection of the intergenic region revealed a lack of a putative promoter sequencefor the cjaB gene. On the other hand, an inverted repeat (AAAGGGCTTTTGCCCTTT) which potentiallymight regulate mRNA stability, was found in that region. The features described above are also characteris-tic for the intergenic region between cj0981c and cj0982c of C. jejuni NCTC11168 and their orthologues inC. jejuni 81176 (Fig. 2).

Identification of the transcription start site and the promoter region. The transcription start site forthe cjaAB was determined by rapid amplification of cDNA ends (RACE). Sequencing of the resul-ting amplicon showed that the first base of the transcript was located 46 bp upstream from the ATGstart codon. Examination of the sequence located upstream of this point revealed putative �10 (TATAAT),�16 (TTTTTaaag) and �35 (TTGAaA) promoter sequences. It also contains periodically repeated T-stretcheslocated upstream of the TATA box (thymines are predominant in regions � 18 to �24 and �29 to �35). Thetranscription is initiated at a pyrimidine (cytydine) located 7 nucleotides from the first nucleotide of the TATAbox. The similarity between the nucleotide sequence of the �35 region and that recognised by F70 E. coli RNApolymerase probably accounted for the expression of this operon both in Campylobacter and E. coli.

Characteristics of the putative CjaB protein. The deduced amino acid sequence of the 49.8 kDa(415 aa) CjaB exhibits a significant overall similarity to several prokaryotic transmembrane polypeptidesthat belong to the MFS group, family 6 (MHS � metabolite: H+ symporter). Members of this family includetransporters of citrate, $-ketoglutarate and osmoprotectants (proline and betaine) as well as some permeasesof unknown transport function (Pao et al., 1998). The CjaB protein contains three signature sequences spe-cific for the family. The MFS superfamily groups inner membrane proteins with 12 to 14 transmembranehelices (TMs). In silico analysis of the CjaB amino acid sequence revealed the presence of 12 hypotheticalTMs, each about 20 amino acids long. The N-terminus of the protein is predicted to be cytoplasmic.

The organisation into one operon of two genes, cjaA and cjaB, with seemingly unrelated functions, ledus to assess the function of the C. coli cjaB gene product. For this purpose, the cjaB gene was disrupted byinsertion of an antibiotic cassette (see Materials and Methods). The mutant showed growth characteristics,at least on rich media, similar to those of their parental strains. Because the deduced amino acid sequence ofthe CjaB exhibits a significant overall similarity to prokaryotic transmembrane transporters of citrate andosmoprotectants (proline and betaine), its function was further investigated by complementation of theE. coli strain WG350. This mutant is deficient in the transport of osmoprotectants (Culham et al., 1993).Introduction of pUWM201 carrying the cjaAB operon into E. coli WG350 did not restore its ability to growin minimal medium (MOPS) supplemented with 0.6 M NaCl and 1 mM proline. PUWM 201 was alsointroduced into E. coli DH5" and the growth of transformants was monitored on minimal citrate medium.In neither case the CjaB protein produced by pUWM201 complements the defect of E. coli indicating that itis involved neither in osmoprotection nor citrate transport.

To learn more about the CjaB protein, its evolutionary relationship to other transporters was investigated.According to the analysis reported by Saier et al. (1999), the MHS family comprises four subfamilies,represented by CitA Eco (Citrate transporter), PcaT Eco (dicarboxylic transporter), ProP Eco (proline/betainetransporter) and MopB Bce (4-methyl-O-phthalate transporter), respectively. Fig. 3 shows the phylogenetictree based on the multiple sequence alignment of the MHS proteins (family metabolite: H+ symporter),comprising the new members identified in the course of our analysis, including CjaB, as well as the SHSand SP families, used as an outgroup of the MHS family. The topology of the tree with respect to thelocation of the MHS, SHS, and SP families as well as the distribution of the CitA, PcaT, MopB and ProPsubfamilies, are in accordance with the results of the earlier analysis of the transporter family reported by

C. coli 72Dz/92 TAA CAAAAAAGGGC· TTTTGCCCTTTAGTTGATTTAGGATAAAAT ATGC. jejuni 81176 TAA T· · · AAAGGGCTTTTTGCCCTTTAGTTGATTTAGGATAAAAT ATGC. jejuni NCTC11168 TAA T· · · AAAGGGCTTTTTGCCCTTTAGTTGATTTAGGATAAAAT ATG

Fig. 2. The comparison of the nucleotide sequence of C. coli 72Dz/92 cjaA- cjaB intergenic region with itscounterparts from C. jejuni NCTC11168 and C. jejuni 81176


Saier et al. (1999). Strikingly, our analysis reveals that CjaB and its close homologues do not group togetherwith any of the previously defined subfamilies, but instead form a completely new subfamily. In addition tothe CjaB subfamily, our analysis has led to the identification of additional two MHS subfamilies (indicatedas A and B in Fig. 3), which form clearly distinct branches in the MHS family tree, with strong bootstrapsupport. All three new subfamilies delineated by our analysis comprise functionally uncharacterised proteins.

Detailed analysis of the phylogeny of the CjaB subfamily reveals several duplications. The CjaB proteinfrom C. coli has an orthologue in the completely sequenced genome of the C. jejuni strain NCTC11168, butno orthologues in the completely sequenced genomes of Helicobacter pylori strains J99 and 26695. Inter-

Fig. 3. The phylogenetic tree of the MHS, SHS and SP protein families.Major subfamilies reported and analyzed previously (Saier et al., 1999) have been shown in simplified representation, as black triangles.The newly identified subfamilies have been shown in detail. Proteins are indicated by the Gene Identification number and the species name.Numbers at the nodes indicate the % bootstrap support (calculated based on 1000 pseudoreplications). Nodes with bootstrap support <50% havebeen collapsed and are shown as unresolved. Gene duplications in the evolution of the CjaB subfamily are indicated by circles at the nodes

corresponding to the duplication events.


estingly, CjaB is an out-paralogue of a lineage grouping orthologous proteins from both strains of H. pylori(present in their genomes as single copies) and two in-paralogous copies in the genome of C. jejuniNCTC11168. The proliferation of CjaB paralogues in C. jejuni suggests that these proteins may be functio-nally diversified and for instance exhibit different preference for the transported substrates.

Transcriptional analysis of cjaAB-lacZ reporter fusions. The arrangement of the C. coli DNA regioncontaining the cjaA and cjaB genes suggested that the two genes are co-transcribed. CjaAB::lacZ reportergene fusions were used to study the regulation of the putative cjaAB operon expression. A set of cjaAB-lacZoperon fusion were constructed in which progressively longer fragments of the cjaAB coding sequence werefused to the promotorless lacZ gene in the shuttle vector pMW10 (Wosten et al., 1998). It is equipped withtranslational stop codons in the three reading frames present between polylinker and lacZ gene.

Recombinant plasmids (pUWM472, pUWM477, pUWM471, pUWM272 and pUWM273) were obtainedby insertion of appropriate PCR amplified Campylobacter DNA fragments into pMW10 previously cut withBamHI and XbaI, or by subcloning. All of them but one (pUWM273) contained the �591 to +1 cjaAupstream region (+1 is the experimentally determined transcription start point, see above). Details of thevector structures are depicted in Fig. 4A. $-galactosidase activity indicated that the fusion present inpUWM273 was not expressed in C. coli and the level of $-galactosidase from this fusion in E. coli was verylow (Fig. 4B). This suggested that cjaA and cjaB are co-transcribed. Maximum activity of $-galactosidase(~2000 units) was reached in cultures of C. coli carrying pUWM477 and pUWM471, that harbour thereporter gene inserted into cjaA. The level of $-galactosidase from the fusion with lacZ downstream of the5� end of cjaB (pUWM272) was approximately six times lower than that from the fusion with lacZ withincjaA. Unexpectedly, the fusion carried by pUWM472, containing only the cjaA upstream region, was notexpressed in Campylobacter.

Generally, the activities observed in E. coli were significantly lower than in Campylobacter. This wasmost pronounced for the fusion with the reporter gene inserted into cjaA. Interestingly, the operon fusionpresent on pUWM472 was expressed in E. coli, in contrast to the results determined for C. coli.

pUWM272 316.7 (± 95) 27.6 (± 6)

pUWM273 0.1 (± 0.2) 1.3 (± 1.3)

pUWM471 1827.6 (± 444) 62.4 (± 12)

pUWM472 3 (± 1.6) 248 (± 8)

pUWM477 1720.7 (± 188) 29.8 (± 5)

plasmid$-galactosidase activity (Miller Units) (± SD)

C. coli 72Dz/92 E. coli DH5"

Fig. 4. Transcriptional analysis of cjaAB � lacZ reporter fusions.A. The scheme of the plasmids, derivatives of pMW10, containing fragments of cjaAB operon used in expression studies. Names of therecombinant plasmids are indicated on the left. Promoter of the cjaAB operon is indicated by arrow.The result of expression studies of cjaAB

operon in both E. coli DH5á and C. coli 72Dz/92.B. The $-galactosidase activity (Miller Units) in E. coli and C. coli harbouring plasmids containing fragments of cjaAB operon. Strains were

grown on rich media: BA base No 2 (C. coli) and LB (E. coli). The assays of $-galactosidase activity were carried out in triplicate.

B

A


Transcriptional analysis of the putative cjaAB operon by RT-PCR. The differences in $-galactosi-dase activity observed for C. coli carrying different operon fusions could be due to different mRNA stabilityor its secondary structure influencing the level of translation. To distinguish between these two possibilitieswe measured the amount of lacZ gene transcript using RT-PCR. All the products obtained were of expectedsize and the absence of products in the reactions without RT (data not shown) clearly demonstrated that thebands observed with reverse transcriptase were derived from mRNA and not from contaminating DNA(Fig. 5). Two primers complementary to the aph vector gene were employed to standardise the assay (datanot shown). No RT-PCR product was observed for bacteria carrying pUWM273. This confirmed that thelack of $-galactosidase activity in these cells was due to the lack of a promoter region, and thus proved thatcjaA and cjaB are co-transcribed. The differences in the amount of the amplified product from bacteriacarrying constructs with the reporter gene in different regions of the operon (pUWM477 vs. pUWM272)clearly correlated with the level of $-galactosidase activity. Contrary to expectations, RT-PCR showed thepresence of specific mRNA transcribed from pUWM472. The nucleotide sequence of the insert carriedby pUWM472 was checked by sequencing and was shown to be correct. The nucleotide sequence ofthe cjaA upstream region present in Campylobacter genome differ from that of pUWM472 by the lengthof the 5� untranslated region. Apparently, the secondary structure of this mRNA region completely abolishedtranslation in C. coli, while it did not influence the interaction of the mRNA with E. coli ribosomes.

Discussion

CjaA encoded by the first gene of the cjaAB operon is an extracytoplasmic solute receptor (Wyszyñskaet al., 2003), component of the ABC transport system. In most bacterial genomes the genes for proteins ofthe ABC-type uptake system are organised in operons containing three, four or five genes (Boos and Lucht,1994). Thus, when compared to other Gram-negative bacteria, the C. coli cjaA gene is unique. The secondgene of the operon, cjaB, encodes a protein belonging to the MFS group (family 6). Genes coding for MFSpermeases generally are separate transcription units. However, in the light of known facts concerning theorganisation of the Campylobacter genetic material the cjaAB operon reflects unusual and still mysteriousCampylobacter gene arrangement. To date only a few Campylobacter operons have been investigated experi-mentally. One of them contains the fur gene involved in the ferric uptake system. It has been shown that furis co-transcribed with two housekeeping genes, lysS and glyA (van Vliet et al., 2000).

Expression of the reporter gene lacZ placed in cjaA leads to a very high level of $-galactosidase (about2000 Miller units) ranking the cjaA promoter among the strongest so far described Campylobacter promot-ers (Wosten et al., 1998). Given that Campylobacter spp. are unable to use carbohydrates as a primarycarbon and energy source and that amino acids can serve not only as a nitrogen but also as a carbon/energysource, the high expression of cjaAB could be expected. The protein encoded by the first gene, CjaA, ispotentially present in a much higher amount compared to the product of the second gene of the operon,CjaB, as was indicated by $-galactosidase activity. High level of CjaB, an integral membrane transporterof an unknown substrate, might be toxic for cells. The RT-PCR analysis showed that the unequal amountsof the products of the two genes resulted from a modulation process that influences mRNA stability. Twoinverted repeats (IR) located downstream of cjaA are possibly responsible for the protection of mRNA from3�→5� exonucleolitic degradation, which causes accumulation of cjaA mRNA (Grunberg-Manago, 1999).

Fig. 5. RT-PCR analysis of the cjaAB operon transcription.The reaction was carried out with two pairs of oligonucleotide primers: comple-mentary to lacZ gene. The primers for the lacZ gene amplified a 307 bp product.There was no product when reverse transcriptase was omitted. Total RNA wasfrom C. coli containing the following recombinant plasmid: Line: 1. pUWM273;2. pUWM471; 3. pUWM472; 4. pUWM477; 5. pUWM272; 6. pMW10; 7. markers.

1 2 3 4 5 6 7 kb

0.5

0.25


Similar IR sequences were found downstream of the first genes of several ABC-type transporter operons(Boos and Lucht, 1994).

The C. jejuni genome is AT rich. Due to the specific nucleotide sequence of the region located upstreamof the TATA box, we postulate that the cjaAB promoter is recognised by C. coli RpoD-RNAP. Transcriptionis initiated at a cytidine, which is uncommon for RNAP with the main sigma factor, at least in E. coli(Barrios et al., 1999). Although the �35 region of the promoter is almost identical to that recognised byE. coli F70 RNAP the level of the reporter gene product was much lower in E. coli than in C. coli. Thissuggests that the cjaAB promoter specific for Campylobacter RpoD RNAP shows a rather low affinity forE. coli F70 RNAP.

Taken together, the reporter gene experiments and RT-PCR studies showed that the cjaA and cjaB genes,belonging to different transporter superfamilies, are co-transcribed and that the stability of mRNA is re-sponsible for varying amounts of the products of the two co-transcribed genes. In addition, unlike in otherGram-negative bacteria, but similar to some Gram-positive bacteria, the cjaA gene is possibly constitutivelytranscribed by RpoD RNAP. Unfortunately, the CjaB substrate still remains unknown. It is noteworthy thatCjaB family members are absent from other g-Proteobacteria with complete genomes, namely H. hepaticus,which occupies a different ecological niche than C. coli, C. jejuni or H. pylori, and non-pathogenic Wolinellasuccinogenes. It suggests that the members of the CjaB subfamily may be involved in the transport ofsubstrates present only in stomach or small intestine.

Acknowledgements. This study received partial financial support from State Committee for Scientific Research (grantNo 6P06K 043 21) and University of Warsaw (grant No. 140-501/68-1561-69). D. Pawelec was supported in part by a short-termfellowship from FEMS. J.M. Bujnicki was supported by the EMBO/HHMI Young Investigator Programme and by a fellowshipfrom the Foundation for Polish Science. We thanks A. Zarêbska for technical assistance. E. coli WG350 was kindly provided byProf. Janet M. Wood (Department of Microbiology, University of Guelph, Canada).

Literature

A l t s c h u l S.F., T.L. M a d d e n, A.A. S c h a f f e r, J. Z h a n g, Z. Z h a n g, W. M i l l e r and D.J. L i p m a n. 1997. GappedBLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389�3402.

B a r r i o s H., B. Va l d e r r a m a and E. M o r e t t. 1999. Compilation and analysis of sigma(54)-dependent promoter sequences.Nucleic Acids Res. 27: 4305�4313.

B o o s W. and J.M. L u c h t. 1994. Periplasmic binding protein dependent ABC transporters, p. 1175�1210. In: H.E. Umbarger(eds), Escherichia coli and Salmonella. Cellular and Molecular Biology. American Society for Microbiology, Washington, DC.

B u l t C.J., O. W h i t e, G.J. O l s e n, L. Z h o u, R.D. F l e i s c h m a n n, G.G. S u t t o n, J.A. B l a k e, L.M. F i t z G e r a l d,R.A. C l a y t o n, J.D. G o c a y n e, A.R. K e r l a v a g e, B.A. D o u g h e r t y, J.F. T o m b, M.D. A d a m s, C.I. R e i c h,R. O v e r b e e k, E.F. K i r k n e s s, K.G. W e i n s t o c k, J.M. M e r r i c k, A. G l o d e k, J.L. S c o t t, N.S. G e o g h a g e nand J.C. Ve n t e r. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science273: 1058�1073.

C h a n V.L., E.K. H a n i, A. J o e, J. L y n e t t, D. N g and M. S t e e l e. 2000. The hippurate hydrolase gene and other uniquegenes of Campylobacter jejuni, p. 455�463. In: M.J. Blaser (eds), Campylobacter, 2nd edition. ASM Press, Washington, DC.

C o k e r A.O., R.D. I s o k p e h i, B.N. T h o m a s, K.O. A m i s u and C.L. O b i. 2002. Human campylobacteriosis in develo-ping countries. Emerg. Infect. Dis. 8: 237�244.

C u l h a m D.E., B. L a s b y, A.G. M a r a n g o n i, J.L. M i l n e r, B.A. S t e e r, R.W. v a n N u e s and J.M. W o o d. 1993.Isolation and sequencing of Escherichia coli gene proP reveals unusual structural features of the osmoregulatory proline/betaine transporter, ProP. J. Mol. Biol. 229: 268�276.

D e c k e r t G., P.V. W a r r e n, T. G a a s t e r l a n d, W.G. Yo u n g, A.L. L e n o x, D.E. G r a h a m, R. O v e r b e e k,M.A. S n e a d, M. K e l l e r, M. A u j a y, R. H u b e r, R.A. F e l d m a n, J.M. S h o r t, G.J. O l s e n and R.V. S w a n s o n.1998. The complete genome of the hyperthermophilic bacterium Aquifex aeolicus. Nature 392: 353�358.

G r u n b e r g - M a n a g o M. 1999. Messenger RNA stability and its role in control of gene expression in bacteria and phages.Annu. Rev. Genet. 33: 193�227.

J i n S., A. J o e, J. L y n e t t, E.K. H a n i, P. S h e r m a n and V.L. C h a n. 2001. JlpA, a novel surface-exposed lipoproteinspecific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol. Microbiol. 39: 1225�1236.

K u m a r S., K. T a m u r a, I.B. J a k o b s e n and M. N e i. 2001. MEGA2: molecular evolutionary genetics analysis software.Bioinformatics 17: 1244�1245.

M e i n e r s m a n n R.J. and T.M. W a s s e n a a r. 2003. Patterns in the intergenic regions of Campylobacter jejuni. Genome Let-ters 2: 28�33.

M i l l e r J.H. 1972. Experiments in Molecular Genetics. New York: Cold Spring Harbor.P a o S.S., I.T. P a u l s e n and M.H. S a i e r, Jr. 1998. Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62: 1�34.P a r k h i l l J., B.W. W r e n, K. M u n g a l l, J.M. K e t l e y, C. C h u r c h e r, D. B a s h a m, T. C h i l l i n g w o r t h, R.M. D a v i e s,

T. F e l t w e l l, S. H o l r o y d, K. J a g e l s, A.V. K a r l y s h e v, S. M o u l e, M.J. P a l l e n, C.W. P e n n, M.A. Q u a i l,M.A. R a j a n d r e a m, K.M. R u t h e r f o r d, A.H. v a n V l i e t, S. W h i t e h e a d and B.G. B a r r e l l. 2000. Thegenome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403: 665�668.


P a w e l e c D., E. R o z y n e k, J. P o p o w s k i and E.K. J a g u s z t y n - K r y n i c k a. 1997. Cloning and characterization ofa Campylobacter jejuni 72Dz/92 gene encoding a 30 kDa immunopositive protein, component of the ABC transport system;expression of the gene in avirulent Salmonella typhimurium. FEMS Immunol. Med. Microbiol. 19: 137�150.

P e t e r s e n L., T.S. L a r s e n, D.W. U s s e r y, S.L. O n and A. K r o g h. 2003. RpoD promoters in Campylobacter jejuniexhibit a strong periodic signal instead of a �35 box. J. Mol. Biol. 326: 1361�1372.

S a i e r M.H., Jr., J.T. B e a t t y, A. G o f f e a u, K.T. H a r l e y, W.H. H e i j n e, S.C. H u a n g, D.L. J a c k, P.S. J a h n,K. L e w, J. L i u, S.S. P a o, I.T. P a u l s e n, T.T. T s e n g and P.S. V i r k. 1999. The major facilitator superfamily.J. Mol. Microbiol. Biotechnol. 1: 257�279.

S a m b r o o k J. and D.W. R u s s e l l. 2001. Molecular Cloning. A Laboratory Manual. New York: Cold Spring Harbor.S p r a t t B.G., P.J. H e d g e, S. t e H e e s e n, A. E d e l m a n and J.K. B r o o m e - S m i t h. 1986. Kanamycin-resistant vec-

tors that are analogues of plasmids pUC8, pUC9, pEMBL8 and pEMBL9. Gene 41: 337�342.T h o m p s o n J.D., T.J. G i b s o n, F. P l e w n i a k, F. J e a n m o u g i n and D.G. H i g g i n s. 1997. The CLUSTAL_X win-

dows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876�4882.

T o m b J.F., O. W h i t e, A.R. K e r l a v a g e, R.A. C l a y t o n, G.G. S u t t o n, R.D. F l e i s c h m a n n, K.A. K e t c h u m,H.P. K l e n k, S. G i l l, B.A. D o u g h e r t y, K. N e l s o n, J. Q u a c k e n b u s h, L. Z h o u, E.F. K i r k n e s s,S. P e t e r s o n, B. L o f t u s, D. R i c h a r d s o n, R. D o d s o n, H.G. K h a l a k, A. G l o d e k, K. M c K e n n e y,L.M. F i t z e g e r a l d, N. L e e, M.D. A d a m s and J.C. Ve n t e r. 1997. The complete genome sequence of the gastricpathogen Helicobacter pylori. Nature 388: 539�547.

v a n V l i e t A.H., J.D. R o c k, L.N. M a d e l e i n e and J.M. K e t l e y. 2000. The iron-responsive regulator Fur of Campylo-bacter jejuni is expressed from two separate promoters. FEMS Microbiol. Lett. 188: 115�118.

W o s t e n M.M., M. B o e v e, M.G. K o o t, A.C. v a n N u e n e and B.A. v a n d e r Z e i j s t. 1998. Identification ofCampylobacter jejuni promoter sequences. J. Bacteriol. 180: 594�599.

W y s z y ñ s k a A., R. G o d l e w s k a and E.K. J a g u s z t y n - K r y n i c k a. 2003. Product of the cjaA (cj0982c) Campylobacterjejuni gene is bifunctional protein. p. 71. In: XIIth International Workshop on Campylobacter, Helicobacter and relatedmicrorganisms. Aarhus, Danmark.


Natural Mannose-Binding Lectin (MBL) Down-regulates Phagocytosisof Helicobacter pylori

DOMINIK STRAPAGIEL1, ANETA GRÊBOWSKA1, BARBARA RÓ¯ALSKA1,LEOKADIA B¥K-ROMANISZYN2, EL¯BIETA CZKWIANIANC2, IZABELA P£ANETA-MA£ECKA2,

TOMASZ RECHCIÑSKI3, WIES£AWA RUDNICKA1 and MAGDALENA CHMIELA1

1 Department of Immunology and Infectious Biology, University of £ód�, 90-237 £ód�,Banacha 12/16, Poland, 2 Institute Mother Health Center, 93-338 £ód�, Rzgowska 281 Poland,

3 Medical University in £ód�, 91-347 £ód�, Kniaziewicza 1/5, Poland

Received 20 December 2005, revised 10 February 2006, accepted 13 February 2006

A b s t r a c t

Considering the role of lectin-carbohydrate interactions between Helicobacter pylori bacteria and the host cells weaddressed the question on how mannose binding lectin � MBL, present in human plasma, may influence the phagocytosisof H. pylori by peripheral blood granulocytes. For phagocytosis assay the granulocytes separated from peripheral bloodof healthy H. pylori-seronegative donors were used. Phagocytosis was estimated by fluorescence assay usingFITC-labelled H. pylori cells. The MBL level in the serum samples as well as MBL-binding to H. pylori bacteria wereestimated by ELISA. In this study all H. pylori isolates bound recombinant mannose binding lectin-MBL as shownby ELISA. The ingestion of H. pylori bacteria in the medium with human serum depleted in natural MBL (nMBL)was more intensive than in the medium with complete serum containing nMBL. Moreover, the ingestion of H. pyloribacteria in the medium with complete serum was increased by an addition of anti-rMBL IgG. The results indicate thatinteraction of bacterial and host lectins may regulate the phagocytosis of H. pylori bacteria and in this way influence anoutcome of the infection caused by these microbes.

K e y w o r d s: Helicobacter pylori, mannose binding lectin (MBL), phagocytosis

Introduction

Helicobacter pylori related gastroduodenal infections are associated with strong infiltration of the gas-tric mucosa by neutrophils, macrophages, lymphocytes and plasma cells (Rudnicka and Andersen, 1999).Despite mobilization of phagocytes to inflammatory foci, the bacteria are not eliminated. It has beensuggested that they may evade destruction by phagocytes due to a temporary persistence in the cytosolof epithelial cells (Petersen and Krogfeld, 2003). Many H. pylori strains express adhesin proteins that bindto specific host cell macromolecule receptors. The best defined H. pylori adhesin-receptor interaction,described by Ilver et al. (1998), is that between the Lewis b (Le b) blood group antigen binding adhesin,BabA, a member of a family of H. pylori outer membrane proteins.

Mahdavi et al. (2002), identified sialyl-dimeric Lewis X glycosphingolipid as a receptor for H. pylori.The corresponding sialic-acid-binding adhesin (SabA) was isolated and the sabA gene was identified(Mahdavi et al., 2002). It has also been established that H. pylori strains express heparan sulphate bindingproteins (Hirmo et al., 1995).

Two molecular mechanisms of microbial recognition by phagocytes are distinguished: direct � opsoninindependent, and indirect � opsonin dependent (Ofek et al., 1995) In our previous study we found thatantibodies specific to various H. pylori antigens may have opposite effects on the course of phagocytosis ofthese bacteria. We showed that opsonization of H. pylori with anti-Lewis X monoclonal antibody (IgM)

1 Corresponding author: Magdalena Chmiela, Department of Immunology and Infectious Biology, University of £ód�, Poland,Banacha 12/16, 90-237 £ód�, Poland. Fax: (48) 42, 6655818; E-mail: [email protected]; Tel: (48) 42, 6354472

96 Strapagiel D. et al. 2

made Lewis X-positive but not Lewis X-negative H. pylori bacteria more susceptible to phagocytosis(Chmiela et al., 1997, 1998, Rudnicka et al., 2001). However, sera from dyspeptic patients with IgG againstH. pylori surface antigens reduced the susceptibility of these bacteria to phagocytosis (Rudnicka et al.,1998). The importance of opsonic activity of the complement in the ingestion of H. pylori bacteria byneutrophils was also shown (Mc Kinlay et al., 1993). On the other hand, Rautelin et al. (1994), showed thatabout one third of H. pylori strains isolated from human gastric biopsy specimens, induced strong chemi-luminescence in neutrophils, even without serum opsonins.

Lectinophagocytosis is a known example of opsonin independent phagocytosis. It includes the reactionbetween surface lectins and carbohydrates on microbial or phagocytic cells (Ofek et al., 1995). Previouslywe showed that interaction between bacterial surface structures such as sialic acid specific haemagglutinins,heparin binding proteins and corresponding phagocyte receptors was necessary for the ingestion of H. pylori(Chmiela et al., 1998). On the other hand, our results suggested that H. pylori can use widely distributedhost compounds: sialic acid or heparin/heparan sulfate glycosaminoglycans, hyaluronic acid or vitronectin(in the presence of complement) to avoid phagocytosis (Chmiela et al., 1998).

Mannose binding lectin � MBL, a C-type lectin, interacts with various microbial carbohydrates (man-nose, N-acetyloglucosamine, fucose and N-acetylomannosamine) (Sastry and Ezekowitz, 1993; Turner,1996). The bacterial capsule and especially LPS could be a major determinant for MBL binding(Devyatyarnova-Johanson et al., 2000). MBL activates complement on lectin pathway, independent of C1qand antibodies, in the presence of MBL-associated serine proteases (MASP1 and MASP2, homologues ofC1q and C1s) (Gal and Ambrus, 2001; Kase et al., 1999; Matsushita and Fujita, 1992). Garred et al. (2003),proposed a dual role of MBL dependent on the lectin�s concentration. Low concentrations have beenassociated with recurrent or severe infections in children and adults caused by extracellular pathogens andalso with autoimmune diseases. High concentrations may enhance targeting of intracellular organisms tohost phagocytes. MBL also modulates disease severity, at least in part through a complex, dose dependentinfluence of cytokine production (Matsushita and Fujita, 1992).

In this study we addressed the question on how MBL may influence the phagocytosis of H. pylori byhuman granulocytes. In order to answer this question we estimated: 1) interaction of MBL with H. pyloriclinical isolates and reference strains, 2) MBL concentration in the sera from H. pylori infected anduninfected children/adolescents and adults, 3) the intensity of H. pylori ingestion by human granulocytesin the presence or absence of natural (nMBL) and recombinant (rMBL) mannose binding lectin as well asanti-rMBL IgG antibodies.

Experimental

Material and Methods

Serum samples. A total of 224 sera were examined for MBL concentration. Sera from H. pylori positive (69) and negative (49)children/adolescents (average age 13 years) diagnosed for H. pylori infection in Mother Health Center Institute in £ód�, Poland,were used for the study. The serum samples from H. pylori positive (66) or negative (40) adult dyspeptic patients (average age53 years) were obtained from K. Jonscher Hospital in £ód�, Poland. H. pylori status was determined by endoscopy, rapid ureasetest and histology. Moreover, in all subjects the titers of anti-H. pylori IgG and IgA antibodies were estimated by immunoenzymatictest � ELISA with glycine acid extract of the reference H. pylori strain, as previously described (Rechciñski et al., 1997). The studywas approved by the local Ethical Committee. All patients signed informed consent.

ELISA for serum MBL concentration. The microtitre plates (Nunc Immunoplate Maxisorp, Nunc, Kastrup, Denmark) werecoated with S. cerevisiae mannan (Sigma, St. Louis, Michigan, USA) at a concentration of 250 µg/ml in carbonate buffer pH 9.6(Aittoniemi et al., 1996). The plates were washed with phosphate buffered saline (PBS), pH 7.4, containing 0.05% Tween 80(PBS/T), and the remaining binding sites were blocked with 1% bovine serum albumin, BSA, Sigma, in PBS (PBS/BSA). Next theserum samples diluted 1 :40 and 1 :80 in Tris-HCl pH 8.0 with 50 mM CaCl2 (Tris-HCl/CaCl2) supplemented with 1% BSA wereadded to the wells and the plates were incubated for 2 h, at 37°C. After washing, the plates were incubated for 2 h, at 37°C withrabbit antibodies against recombinant human MBL (rMBL), and then for 1 h with swine antibodies against rabbit immunoglobulinslabelled with horseradish peroxidase-HRP (Dako, Glostrup, Denmark). The colour reaction was developed in the presence ofsubstrate solution: 1 mg o-phenylenediamine dihydrochloride-OPD (Sigma) in 1 ml citric-acid phosphate buffer, pH 5.0 supple-mented with 0.5 µl/ml of 30% H2O2. The reaction was stopped with citric acid and the absorbance was measured at 450 nm usingVictor2 reader (Wallak, Oy, Turku, Finland). The standard curve was prepared by incubation of mannan-coated wells with a knownamount of rMBL (0.073� 1.2 µg/ml), and then with rabbit anti-rMBL antibodies and swine-HRP antibodies to rabbit immuno-globulins. In every ELISA the control wells were used for excluding the unspecific reactions.

Sera depleted in MBL. For phagocytosis assay two types of serum samples were used: 1) containing nMBL; 2) depletedin nMBL by absorption with S. cerevisiae mannan coated sepharose (Sigma, St. Louis, Michigan, USA) (Kase et al., 1991).In brief, 500 µl of mannan bound sepharose was sedimented by centrifugation for 2 min, 300×g, and stabilized for 18 h, at 4°C with

97Role of MBL in H. pylori phagocytosis2

Tris-HCl/CaCl2. Equilibrated sepharose was centrifuged, then resuspended in 1 ml of serum containing 2 mM CaCl2, and incubatedfor 30 min, at 4°C with agitation. After sedimentation of sepharose, the supernatant was collected for estimation of MBL concentra-tion by ELISA, as described above.

Bacterial strains and culture conditions. The H. pylori reference strains 17 874 and 17 875 were obtained from the CultureCollection, University of Gothenburg (CCUG), Gothenburg, Sweden. Clinical isolates (31) were from dyspeptic children/adoles-cents and adults being under the care of Mother Health Center Institute and K. Jonscher Hospital in £ód�, Poland. The bacteriawere stored at �70°C in tryptic soy broth containing 15% glycerol. Before being used in experiments the bacteria were cultured for48 h, at 37°C in microaerophilic conditions on blood agar containing 10% heat inactivated fetal calf serum. The Mycobacteriumbovis reference strain from Polish Bacterial Culture Collection was grown for 2�3 weeks at 37°C, 5% CO2 on Middelbrook 7H9medium (Difco, Detroit, Michigan, USA) containing 0.05% Tween 80 and ADC supplement (Becton Dickinson, Spartaks, USA).

Interaction of MBL with H. pylori. The interaction of MBL with H. pylori cells (33 strains) was estimated by ELISA assay onmicroplates coated for 18 h, at 4°C, with H. pylori and M. bovis (low binding control) bacterial suspensions, 1×107 cells/ml in PBS,pH 7.4 (100 µl/well). Positive ELISA control with rMBL coated wells (0.5 µg/ml) was also included. Unbound plastic was blockedwith PBS/BSA. After washing the plates (once with PBS and three times with Tris-HCl/CaCl2/ BSA) the rMBL (5 µg/ml inTris-HCl/CaCl2/BSA) was added to the wells (100 µl/well), and the plates were incubated for 2 h at 37°C. Next, the assay wascontinued as described above.

FITC labelling of H. pylori bacteria. The bacteria collected from the plates were washed once with PBS and resuspended insuch buffer containing 100 µg/ml fluoresceine isothiocyanate (FITC). The mixture was agitated for 30 min at room temperature.The bacteria, after extensive washing with PBS, were resuspended with PBS containing 4% bovine serum albumin (BSA), to bindunconjugated FITC to BSA. After 15 min incubation at room temperature, the bacteria were washed and resuspended at 1×106 cell/mlin RPMI-1640 medium.

Phagocytosis. Polymorphonuclear leukocytes (PMNs) were separated from human fresh blood collected from healthy indi-viduals by veinpuncture with heparin as an anticoagulant, by Polymorphoprep gradient centrifugation (Nycomed, Oslo, Norway).For phagocytosis, PMN suspensions (1×106 cells/ml) were prepared in 1ml volume of RPMI-1640 with gentamycin (5 µg/ml),containing: 1) 20% complete non-inactivated human serum containing 30 µg/ml of nMBL or 20% such serum with or without 10%rabbit anti-human rMBL antibodies; 2) 20% nMBL depleted serum; 3) 20% nMBL depleted serum and rMBL at a concentration ofnMBL (30 µg/ml). The cells suspended in an appropriate medium were added in triplicate to the wells of microplate (100 µl/well)and supplemented with fluoresceine isothiocyanate (FITC)-labelled bacteria in RPMI-1640, at the ratio 1 : 10 or 1:100, andthen incubated for 1h, at 37°C, 5% CO2. Phagocytosis was stopped on ice. The unbound bacteria were removed by washing thecells with ice-cold PBS with gentamycin (PBS/G). The fluorescence was measured using Victor2 reader with 480/530 nm excita-tion/emission filters. Afterwards extracellular fluorescence was quenched with crystalline violet (500 µg/ml in PBS). The dye wasexchanged with PBS/G. The intensity of fluorescence was measured as above, and expressed in relative fluorescence units (RFU)� fluorescence counts. The wells containing FITC labelled bacteria alone were used as control of quenching effectiveness. In eachexperiment a standard curve for quantitation of FITC labelled H. pylori bacteria was prepared. Serially diluted bacterial cell suspen-sions in RPMI-1640 medium, were distributed into the wells, and the fluorescence of bacteria was measured. The values of fluores-cence were plotted as a function of the number of bacteria in each well (Chmiela et al., 1997).

Detection of C5b-C9 complement complexes. Activation of complement during phagocytosis was estimated immunoenzima-tically by dot blot method using monoclonal antibodies against C5b-C9 complexes (Dako). Two microliters of post phagocytosissupernatants were dropped three times on the BA 85 membrane (Schleicher and Schuel, Dassel, Germany). After blocking with2% BSA in Tris-HCl/200mM NaCl, pH 7.4 (Tris-HCl/NaCl/BSA) the membranes were incubated for 18 h, at room temperaturewith mouse monoclonal antibodies to C5b-C9 complex, diluted 1 :40 in Tris-HCl/NaCl/BSA. After washing the membranes withTris-HCl/NaCl containing 0.5% Tween 80, rabbit antibodies to mouse immunoglobulins labelled with HRP (diluted 1 :1000with Tris-HCl/NaCl/BSA) were added and the membranes were stored for 2 h at room temperature. The color reaction was developedusing 1 ml of 4-chloro-1-naphtol (3 mg/ml, Sigma) mixed with 5 ml of Tris-HCl/NaCl (1:5) and with 30% H2O2 (0.5 µl/ml), andthen stopped with H2O. The appropriate controls excluding unspecific reactions were included into the study.

Statistics. Results were compared using the Statistica 5.5 PL program with unpaired Student�s t-test and Chi-square P2 test. Thedifference was significant when p<0.05.

Results

The level of MBL in H. pylori infected and uninfected individuals. There was a high variation inMBL amount in the serum samples in each group under the study (Table I). The MBL concentration wasin the range 2�50 µg/ml. There was no significant difference in the frequency of the MBL concentration:0�2 mg/ml; 2�4 µg/ml; 4�10 µg/ml and >10 µg/ml, between the groups of H. pylori infected and uninfectedchildren/adolescents and adults or between males and females.

The interaction of H. pylori with MBL. The H. pylori-MBL interaction was evaluated for 31 clinicalisolates and two reference strains. The results showed that all H. pylori strains interacted with rMBL wheninvestigated by ELISA. The specific ELISA OD450 counts for H. pylori strains were in the range 1.0�2.0(mean 1.5 ± 0.25) and for M. bovis 0.2�0.6 (mean 0.4 ± 0.05) (Table II). Positive ELISA counts for rMBLcoated wells were in the range 0.8�1.0.

The intensity of phagocytosis of FITC-H. pylori bacteria by granulocytes in the presence or absenceof MBL. The phagocytosis of MBL-binding H. pylori reference strain CCUG 17874 by human granulocytes,


H. pylori 1.0 � 2.0 1.5 ± 0.25 0.1 � 0.4

M. bovis (low binding control) 0.2 � 0.6 0.4 ± 0.05 0.03 � 0.04

rMBL (positive ELISA control) Range 0.8�1.0

Table IIThe interaction of recombinant mannose binding lectin (rMBL) with H. pylori

and M. bovis estimated by ELISA

The interaction of rMBL with H. pylori and M. bovis was estimated by ELISA using S. cerevisiaemannan as coating antigen. Polyclonal rabbit anti-rMBL IgG were used for recognition of MBLbound with bacterial cells and swine antibodies against rabbit immunoglobulins labeled with horse-radish peroxidase for detection of such complex.

Bacterial strains

ELISA

Specific OD450

counts Range of unspecificOD

450 countsrangemean

Children/adolescentsH. pylori (+) mean: r = 2.0�38.0 12/69 6/69 24/69 27/69

n = 69 10.1 ± 9.0 (17%) (9%) (35%) (39%)

H. pylori (�) r = 2.0�49.6 5/49 6/49 16/49 22/49n = 49 mean: 12.2 ± 10.9 (10%) (12%) (33%) (45%)

AdultsH. pylori (+) r = 2.0�30.5 10/66 8/66 19/66 29/66

n = 66 mean: 9.6 ± 7.6 (15%) (12%) (29%) (44%)

H. pylori (�) r = 2.0 ± 43.2 7/40 6/40 11/40 16/40n = 40 mean: 10.4 ± 10.7 (18%) (27%) (27%) (40%)

Table IThe concentration of MBL in the sera from children/adolescents and adults infected

or uninfected with H. pylori

Group investigated

Serum MBL concentration (µg/ml)Prevalence (%)

Range (r) Below 2.0 r: 2.0�4.0 r: 4.0� 10.0 >10.0

n � number of subjects

1284 1940 1.5 3372 2.6 2848 2.2

1048 5707 5.4 4578 4.3 1125 1.0

1486 1.0 4169 2.8 6180 4.1 1161 0.8

2560 6074 2.3 5759 2.2 2926 1.1Mean: Mean: Mean: Mean: Mean: Mean: Mean:

1595 ± 668 1.0 4473 ± 1879 3.0 4972 ± 1264 3.3 2015 ± 1008 1.3

Table IIIThe intensity of phagocytosis of FITC-labelled H. pylori bacteria by human granulocytes in the presence or absence

of natural (nMBL) or recombinant mannose binding lectin (rMBL) and anti-rMBL antibodies

Phagocytosis milieu

supplemented with: 20% serumcontaining 30 µg/ml nMBL

(control culture)

supplemented with:20% nMBL-depleted serum

supplemented with: 20% serumcontaining 30 µg/ml nMBLand anti-rMBL rabbit IgG

supplemented with:20% nMBL depleted serum

and 30 µg/ml rMBL

Fluorescencecounts

Phagocytosisindex

The ingestion of H. pylori-FITC labeled bacteria by granulocytes was estimated fluorimetrically. The intensity of phagocytosis was expressed asmean of the fluorescence counts from four experiments, evaluated in the fluorescence reader Victor2. The phagocytosis index was calculated withrelation to the intensity of phagocytosis in the medium supplemented with 20% of serum containing 30mg/ml nMBL (control culture).

Difference statistically significant (p< 0.05).

Fluorescencecounts

Fluorescencecounts

Phagocytosisindex

Phagocytosisindex

Fluorescencecounts

Phagocytosisindex

▲

▲

▲


in the medium with 20% of complete human serum containing natural MBL-nMBL (30 µg/ml), was ex-pressed as relative fluorescence units � RFU (1595 ± 668) and as Phagocytosiss Index 1.0 (Table III).The replacement of the complete serum by the same serum depleted in nMBL (nMBL-depleted serum)on mannan coated sepharose caused a significant (p<0.05) increase of fluorescence counts from 1595 ± 668to 4473 ± 1879 and Phagocytosis Index up to 3.0. The preservation of complement activity in MBL--depleted serum was proved by using monoclonal anti-C5-C9 complex antibodies. Data in Table III alsoshow that addition of rabbit IgG against recombinant MBL (rMBL) to the phagocytosis samples withhuman complete serum containing natural MBL increased the fluorescence counts from 1595 ± 668 to4972 ± 1264 and Phagocytosis Index from 1.0 to 3.3. The replenishment of removed human serum by theaddition of rMBL did not cause the increase of phagocytosis intensity (RFU 2015 ± 1008, PhagocytosisIndex 1.3) as compared with the intensity of ingestion in the medium with nMBL (RFU 1595 ± 668, Phago-cytosis index 1.0).

Discussion

Previously we showed that interaction between H. pylori surface structures, namely sialic acid-specifichaemagglutinin or heparin/heparan sulfate binding proteins, and corresponding macrophage receptors isrequired for engulfment of H. pylori bacteria. On the other hand, these microbes can use host�s sialylatedcompounds, heparin/heparan sulfate glycosaminoglycans, hyaluronic acid or vitronectin in the presence ofcomplement to escape phagocytosis (Chmiela et al., 1998; Drogari-Apiranthitou et al., 1997; Rudnickaet al., 1998, 2001).

In this study we found that all H. pylori strains bound recombinant MBL as estimated by ELISA. Thesebacteria bound MBL more intensively than the cells of M. bovis. Fungi of Candida species and Aspergillusfumigatus as well as bacteria Staphylococcus aureus, exhibited strong binding of MBL, whereas Escherichiacoli, Klebsiella spp., and Haemophilus influenzae type b were characterized by heterogenous binding patterns(Neth et al., 2000). In contrast, beta-haemolytic group B streptococci, S. pneumoniae and S. epidermidisshowed low levels of binding. The MBL binding by H. pylori could be mediated by mannose residuesin various bacterial cell surface structures but also by fucose moieties of Lewis X or Lewis Y determinantspresent in the LPS of the majority of H. pylori strains (Moran et al., 1996). Jack et al. (2001) andDevyatyarnova-Johanson et al. (2000), showed that bacterial LPS was of major importance in determiningthe binding of MBL to Gram-negative organisms Salmonella spp. and Neisseria spp.

In general, it is thought that MBL mediates protection against infections due to its opsonic activity, byactivating the complement system in the presence of MASP (Garred et al., 2003; Matsushita and Fujita,1992). However, in this study the H. pylori bacteria were ingested more intensively by human granulocytesin the medium with MBL-depleted or anti-MBL sera as compared with the intensity of phagocytosis in themedium with complete fresh sera containing natural MBL (nMBL). The complement was possibly involvedin this process. During phagocytosis, in the presence of complete serum, the lytic complex could be gener-ated on lectin pathway due to the interaction of nMBL with H. pylori bacteria. In the post-phagocytosissupernatants the C5b-C9 terminal complement complex was detected. The lysis due to complement coulddiminish the number of ingested bacteria in the milieu of nMBL. The complement could be activated onlectin pathway both in the medium with or without nMBL, by serum ficolins which may bind mannose orGlcNAc present on the surface structures of H. pylori (Holmskov et al., 2003; Matsushita et al., 2001).During the depletion of the sera in nMBL the activity of C5b-C9 complex was preserved. The mechanismof antibody blocking of the MBL inhibition of phagocytosis could be through blocking of nMBL bindingto H. pylori or blocking of its inhibiting qualities. The interaction of anti-MBL IgG with nMBL bound tomannose residues on the surface of granulocytes or binding of nMBL-anti-nMBL IgG complexes to phago-cyte Fc receptors could not be excluded. Another explanation for diminished phagocytosis of H. pylori inthe medium containing nMBL as compared to the medium without nMBL is that bacteria avoid phagocyto-sis by intensive nMBL binding, a phenomenon which was earlier observed by us for vitronectin and sialicacid (Chmiela et al., 1998). MBL may mask the H. pylori surface adhesins important for recognition andengulfment of these bacteria by phagocytes. A weak H. pylori phagocytosis in nMBL-depleted serum withrMBL confirms this suggestion. The more extreme environment for MBL binding in the gastric mucosa,where phagocytic cells infiltrate during infections, can be neutralized by H. pylori urease. Similarly, to theresults of our study, Swanson et al. (1998), showed the 50% inhibition of the interaction of Chlamydiatrachomatis, C. pneumoniae and C. psittaci with the leukocytes by rMBL.


Considering the known role of phagocyte receptors for Fc fragment of IgG (Fc(R) in the ingestion ofbacteria it was interesting to compare the outcome of H. pylori phagocytosis in the medium with the serafrom H. pylori infected individuals, seropositive for anti-H. pylori IgG and from uninfected, seronegativedonors. In this study, we could see no difference in the ingestion of MBL-binding H. pylori bacteria in themedium with sera containing or free of anti-H. pylori IgG. Similarly, we observed no significant differencein the MBL levels in the sera from H. pylori infected or uninfected children and adults. Also Klabunde et al.(2000), showed no differences in serum MBL concentration in the patients infected with Schistosoma sp.and in healthy controls though Schistosoma cercariae and adult worms, like H. pylori, bind MBL. In con-trast, MBL deficiencies were detected with a high frequency in the patients infected with HIV, hepatitis Bvirus or Neisseria meningitides (Devyatyarnova-Johanson et al., 2000; Saifuddin et al., 2000; White et al.,2000). The lack of significant correlation between MBL concentration and H. pylori infection in this cohortstudy implies that MBL is not an essential factor in the disease process. However, in some H. pylori infectedpatients, the elevated MBL concentration by blocking H. pylori phagocytosis may allow these bacteriapermanent colonization of gastric mucosa. In the summary, our results indicate that H. pylori bacteria mayuse MBL to avoid engulfment by phagocytes. The interactions of bacterial compounds and host lectins mayregulate H. pylori phagocytosis and on this way influence an outcome of H. pylori related infections.

Acknowledgments. The authors wish to thank Prof. R.A.B. Ezekowitz for providing rMBL and anti-rMBL antibodies. Thisstudy was supported by a grant of the State Committee for Scientific Research (KBN), Poland 3P05 E045 24.

Literature

A i t t o n i e m i J., A. M i e t t i n e n, P. L a i p p a l a, J. V i i k a r i, T. R u u s k a and E. S o p p i. 1996. Age-dependent varia-tion in the serum concentration of mannan-binding protein. Acta. Pediatr. 85: 906�909.

C h m i e l a M., E. C z k w i a n i a n c, T. W a d s t r o m and W. R u d n i c k a. 1997. Role of Helicobacter pylori surface struc-tures in bacterial interaction with macrophages. Gut 40: 20�24.

C h m i e l a M., B. P a z i a k - D o m a n s k a, S. H i r m o, W. R u d n i c k a, M. U t t and T. W a d s t r o m. 1998. Helicobacterpylori-interaction with phagocytes. In: R.H. Hunt, G.N. Tytgat (eds). Helicobacter pylori, Basic Mechanisms to ClinicalCure. Dardrecht: Kluwer Academic Publishers.

D r o g a r i - A p i r a n t h i t o u M., C.A.P. F i j e n, S. T h i e l, A. P l a t o n o v, L. J e n s e n and J. D a n k e r t. 1997. Theeffect of mannan-binding lectin on opsonophagocytosis of Neisseria meningitidis. Immunopharmacology 38: 93�99.

D e v y a t y a r n o v a - J o h a n s o n M., I.H. R e e s, B.D. R o b e r t s o n, M.W. T u r n e r, N.J. K l e i n and D.L. J a c k. 2000.The lipopolysaccharide structures of Salmonella enterica serovar typhimurium and Neisseria gonorrhoeae determine theattachment of human mannose-binding lectin to intact organisms. Infect. Immun. 68: 3894�3899.

G a l P. and G. A m b r u s. 2001. Structure and function of complement activating enzyme complexes: C1 and MBL-MASPSs.Curr. Protein and Peptide Sci. 2: 43�59.

G a r r e d P., F. L a r s e n, H.O. M a d s e n and C. K o c h. 2003. Mannose-binding lectin deficiency-revisited. Mol. Immunol.40: 73�84.

G a r r e d P., M. H a r b o e, T. O e t t i n g e r, C. K o c h and A. S r e j g a a r d. 1994. Dual role of mannan-binding protein ininfections: another case of heterosis? Eur. J. Immunogenet. 21: 125�131.

H i r m o S., M. U t t, M. R i n g e r and T. W a d s t r o m. 1995. Inhibition of heparan sulphate and other glycosaminoglycansbinding to Helicobacter pylori by various polysulphated carbohydrates. FEMS Immunol. Med. Microbiol. 10: 301�306.

H o l m s k o v U., S. T h i e l and J.C. J e n s e n i u s. 2003. Collectins and ficollins: humoral lectins of the innate immunedefense. Annu. Rev. Immunol. 21: 547�578.

I l v e r D., A. A r n q u i s t, J. O g r e n, I.M. F r i c k, D. K e r s u l y t e, E.T. I n c e c i k, D.E. B e r g, A. C o v a c c i,L. E n g s t r a n d and T. B o r e n. 1998. Helicobacter pylori adhesin binding fucosylated histo-blood group antigensrevealed by retagging. Science 279: 373�377.

J a c k D.L., N.J. K l e i n and M.W. T u r n e r. 2001. Mannose-binding lectin: targeting the microbial world for complementattack and opsonophagocytosis. Immunol. Rev. 180: 86�99.

K a s e T., T. S u z u k i, T. S a k a m o t o, K. O h t a n i, A. M a e d a, Y. O k u n o, T. K u r i m u r a and N. W a k a m i y a.1999. Humann mannan-binding lectin inhibits the infection of influenza A virus without complement. Immunology 97: 385�392

K l a b u n d e J., J. B e r g e r, J.C. J e n s e n i u s, M.Q. K l i n k e r t, U.Z. Z e l c k, P.G. K r e m s n e r and J.F.J. K u n. 2000.Schistosoma mansoni: adhesion of mannan-binding lectin to surface glycoproteins of cercariae and adult worms. Exp.Parasitol. 95: 231�239.

M a h d a v i J., B. S o n d e n, M. H u r t i g, F.O. O l f a t, L. F o r s b e r g, N. R o c h e, J. A n g s t r o m, T. L a r s s o n,S. T e n e b e r g, K.A. K a r l s s o n, S. A l t r a j a, T. W a d s t r o m, D. K e r s u l y t e, D.E. B e r g, A. D u b o i s,Ch. P e t e r s s o n, K.E. M a g n u s s o n, T. N o r b e r g, F. L i n d h, B.B. L u n d s k o g, A. A r n q u i s t,L. H a m m a r s t r o m and T. B o r e n. 2002: Helicobacter pylori SabA adhesin in persistent infection and chronic inflam-mation. Science 297: 573�578.

M a t s u s h i t a M., Y. E n d o, N. H a m a s a k i and T. F u j i t a. 2001. Activation of the lectin complement pathway by ficolins.Int. Immunopharmacol. 1: 359�363.


M a t s u s h i t a M. and T. F u j i t a. 1992. Activation of the classical complement pathway by mannose-binding protein in asso-ciation with a novel C1s-like serine protease. J. Exp. Med. 176: 1497�1502.

M c K i n l a y A.W., A. Yo u n g, R.I. R u s s e l and C.G. G e m m e l l. 1993. Opsonic requirements of Helicobacter pylori.J. Med. Microbiol. 38: 209�215.

M o r a n A.P., B.J. A p p e l m e l k and G.D. A s p i n a l l. 1996. Molecular mimicry of host structures by bacterial lipopoly-saccharides and its contribution to disease. FEMS Immunol. Med. Microbiol. 16: 105�115.

N e t h D.L., D.L. J a c k, A.W. D o d d s, H. H o l z e l, N.J. K l e i n and M.W. T u r n e r. 2000. Mannose-binding lectin bindsto a range of clinically relevant microorganisms and promotes complement deposition. Infect. Immun. 68: 688�693.

O f e k I., J. G o l d h a r, Y. K e i s a r i and N. S h a r o n. 1995. Nonopsonic phagocytosis of microorganisms. Annu. Rev.Microbiol. 49: 239�276.

P e t e r s e n A. and K. K r o g f e l t. 2003. Helicobacter pylori an invading microorganism? A review. FEMS Immunol. Med.Microbiol. 36: 117�126.

R a u t e l i n H., B. B l o m b e r g, G. J a r n e r o t and D. D a n i e l s s o n. 1994. Nonopsonic activation of neutrophils and cyto-toxin production by Helicobacter pylori: ulcerogenic markers. Scand. J. Gastroenterol. 29: 128�132.

R e c h c i ñ s k i T., M. C h m i e l a, E. M a ³ e c k a - P a n a s, I. P ³ a n e t a - M a ³ e c k a and W. R u d n i c k a. 1997. Serologi-cal indicators of Helicobacter pylori infection in adult dyspeptic patients and healthy blood donors. Microbiol. Immunol. 45:387�393.

R u d n i c k a W. and L.P. A n d e r s e n. 1999. Inflammation and host response. Curr. Opin. Gastroenterol. 15: (Suppl. 1), S17�S21.R u d n i c k a W., E. C z k w i a n i a n c, I. P ³ a n e t a - M a ³ e c k a, M. J u r k i e w i c z, M. W i � n i e w s k a, T. C i e � l i k o w s k i,

B. R ó ¿ a l s k a, T. W a d s t r o m and M. C h m i e l a. 2001. A potential double role of anti-Lewis X antibodies inHelicobacter pylori-associated gastroduodenal diseases. FEMS Immunol. Med. Microbiol. 30: 121�125.

R u d n i c k a W., M. C h m i e l a, E. C z k w i a n i a n c, B. P a z i a k - D o m a ñ s k a, B. R ó ¿ a l s k a and I. P ³ a n e t a -M a ³ e c k a. 1998. The ingestion of Helicobacter pylori by macrophages in the presence of sera from children with orwithout dyspeptic symptoms. Bull. Polish. Acad. Sci. 46: 69�77.

S a s t r y K. and R.A.B. E z e k o w i t z. 1993. Collectins: pattern recognition molecules involved in first line host defense. Curr.Opin. Immunol. 5: 59�66.

S a i f u d d i n M., M.L. H a r t, H. G e w u r z, Y. Z h a n g and G.T. S p e a r. 2000. Interaction of mannose-binding lectin withprimary isolates of human immunodeficiency virus type I. J. Gen. Virol. 81: 949�955.

S w a n s o n A.F., R.A. E z e k o w i t z, A. L e e and C.C. K u o. 1998. Human mannose-binding protein inhibits infection ofHeLa cells by Chlamydia trachomatis. Infect. Immun. 66: 1607�1612.

T u r n e r M.W. 1996. Mannose-binding lectin: the pluripotent molecule of the innate immune system. Immunol. Today 17: 532�540.W h i t e M.R., E. G r o u c h, D. C h a n g, K. S a s t r y, N. G u o, G. E n g e l i c h, K. T a k a h a s h i, A.B. E z e k o w i t z and

K.L. H a r t s h o r n. 2000. Enhanced antiviral and opsonic activity of a human mannose-binding lectin and surfactant pro-tein D chimera. J. Immunol. 165: 2108�2115.


Phenotypic and Genotypic Characteristicsof Pseudomonas aeruginosa Strains Isolated from Hospitals

in the North-West Region of Poland

URSZULA CZEKAJ£O-KO£ODZIEJ1,2*, STEFANIA GIEDRYS-KALEMBA1,DAGMARA MÊDRALA2

1 Department of Microbiology and Immunology, Pomeranian Medical University,Szczecin, ul. Powstañców Wlkp. 72, 70-111 Szczecin, Poland

2 Poland Department of Food Microbiology, Agricultural University of Szczecin,ul. Papie¿a Paw³a VI 3, 71-459, Szczecin, Poland

Received 22 June 2005, revised 2 March 2006, accepted 8 March 2006

A b s t r a c t

A total of 90 Pseudomonas aeruginosa strains isolated from 4 hospitals in the west-north region of Poland were studiedby arbitrarily primed polymerase chain reaction (AP-PCR). AP-PCR results revealed the presence of 11 main groupsof patterns (A-K) and 5 unique patterns among isolates. Generally, they were characterized by high resistance toantibiotics tested and significant differences in serogroups and types of growth on Cetrimide Agar medium. It wasobserved that clonally related strains were isolated from patients within the same ward, among different wards as wellas in distant hospitals.

K e y w o r d s: Pseudomonas aeruginosa, arbitrarily primed PCR (AP-PCR), fingerprinting, antibiotic resistance,nosocomial infections

Introduction

Pseudomonas aeruginosa is a Gram-negative, non-fermenting rod widely distributed in nature and hu-man environment. It is responsible for one of the most serious opportunistic infections in humans. In recentyears nosocomial infections caused by P. aeruginosa has been recognized as an acute problem in hospitalsdue to its antibiotic multi-resistance. P. aeruginosa is one of the main causes of nosocomial respiratory tract,urinary tract and surgical site of infection. It is the primary cause of ventilated-associated pneumonia inintensive tract unit (ICU), where individuals are highly susceptible to infection than patients from the otherwards of the same hospital. Severity of illness, underlying disease, immunosupression and invasive devicesespecially mechanical ventilation are risk factors for P. aeruginosa infection (Ayats et al., 1997; Bertrandet al., 2000; Boddie et al., 2003; Cheol-In Kang et al., 2003; Garcia-Garmendia et al., 1999; Garrouste-Orgeas et al., 1996). Patients hospitalized in ICUs have three-fold greater risk of contracting nosocomialinfection and mortality may increase from 13% to 47% (Nikodemski, 1997).

According to the studies conducted by the European Prevalence of Infection in Intensive Care (EPIC)which covered 10 038 patients in 17 western European countries, P. aeruginosa was the third mostfrequently isolated microorganism (28.7% of the total number of isolates) (Spencer, 1993). As reportedby Peacock and Garrad (1997) 16�31% of pneumonia cases diagnosed among artificially ventilatedpatients were connected with P. aeruginosa infections (Peacock et al., 1997). Pneumonia occurrencescaused by P. aeruginosa result in 30�80% of death cases among ICU patients in Polish hospitals(Piotrowska, 1998).

* Corresponding author: Urszula Czekaj³o-Ko³odziej, Agricultural University of Szczecin, Department of Microbiology,ul. Papie¿a Paw³a VI 3, 71-459, Szczecin, Poland, e-mail: [email protected], tel./fax: + 48 91 4250407

104 Czekaj³o-Ko³odziej U. et al. 2

Quite recently epidemiological investigations could rely only on classical methods based on analyses ofphenotypic features, including biotype, serotype and phagotype identification as well as bacteriocin andantibiotic sensitivity of tested strains. To identify a strain precisely several method had to be applied. Pheno-typic tests are expensive, time and labor consuming and very often their results are ambiguous to interpret,e.g. in case of endemic strains (Gospodarek and Waszak, 1995; Gillespie et al., 2000; Hancock et al., 1983;van Belkum, 1994; Versalovic et al., 1993).

Presently, genetic techniques supported by phenotypic tests enable to conduct a detailed characteristic ofstrains isolated from particular time and environment. The aim of such analyses is to precisely evaluateif strains isolated from infected patients are clonally related and transmitted horizontally within the ward orinfections are caused by representatives of various clonal groups. It provides data about sources of infectionand route of microorganism transmission and is of crucial importance for epidemiological investigations,especially those focused on tracing nosocomial infections.

Reliability of performed analyses relies both on a typing method selected as well as on interpretation ofresults. Rightly performed analysis should cover three basic criteria of typing bacterial strains, i.e. typeability,reproducibility and discrimination (Power, 1996; Versalovic et al., 1993). To fulfill the above criteria,a preliminary optimization of applied typing method is usually essential. Lack of standardization leads tonon-reproducibility of the results and their wrong interpretation and may also limit wider applicationof genetic methods in routine clinical diagnostics. Macrorestriction analysis of genomic DNA followedby pulsed field gel electrophoresis (PFGE) has become the gold standard for molecular typing, however,interpretation of PFGE results for P. aeruginosa is very complicated. Efficiency of the method may belimited by species features, e.g. interpretation of pulsed-field gel electrophoresis (PFGE) typing patternsis complicated (Fiett et al., 1998; Kersulyte et al., 1995). Promising results were obtained by applicationof arbitrarily chosen primers in random amplified polymorphic DNA (RAPD), DNA amplification finger-printing (DAF) and arbitrary primed PCR assay (AP-PCR).

The aim of the work was to estimate intra-species differentiation of P. aeruginosa strains isolated from4 hospitals in the west-north region of Poland and to evaluate effectiveness of phenotypic methods such asbiotyping, serotyping, susceptibility to chemotherapeutic agents and type of growth on Cetrimide Agarmedium in the epidemiological investigation.

Experimental


Bacterial strains. A total of 90 P. aeruginosa strains isolated from various clinical specimens in hospitals nos. 1� 4 in the west-north region of Poland during 1996�2000 were examined. Strains were isolated from 56 patients admitted to different wardsof these hospitals. Some patients had P. aeruginosa isolated from one, two sites or from the same specimens collected at differentdays of hospitalization.

Phenotypic study. P. aeruginosa isolates were identified by the biochemical profile index procedure ID 32 GN (bioMérieux,France). Pyocin production was tested on selective Cetrimide Agar (Merck, Germany). O-type lipopolysaccharide was determinedaccording to Habs (1957) protocol based on agglutination test with anti-O sera (Sanofi Pasteur, France ). Susceptibility to antibacte-rial drugs was studied by the disk diffusion method according to CLSI (Clinical and Laboratory Standards Institute, formerlyNCCLS-National Committee for Clinical Laboratory Standards) for following agents: carbenicillin (Cb), piperacillin-tazobactam(Tzp), ceftazidime (Caz), imipenem (Imp), meropenem (Mem), gentamicin (Gn), tobramycin (Tb), netilmicin (Net), amikacin (Ak),pefloxacin (Pef), ciprofloxacin (Cip), colistin (Ks) (Performance standards for antimicrobial susceptibility testing. 1999).

Genetic analysis. DNA was extracted using DNA®ZOL reagent (Gibco, USA) according to the manufacturer�s instructions.DNA concentration was quantified spectrophotometrically at 260 nm/280 nm in GeneQuant RNA/DNA Calculator (PharmaciaBiotech, UK) and diluted if necessary to obtain concentration of 20 ng/µL. To obtain complex and stable amplicon profiles, theorthogonal array assay designed by Taguchi and Wu 1980 and modified by Cobb and Clarkson (1992) was applied.

The PCR was performed in a volume of 25 µL containing 500 mM KCl, 100 mM Tris-HCl (pH 8.3), 1 U of Taq DNApolymerase (Roche, USA), 3.0 mM MgCl2, 2.0 mM of each nucleotide, 30 pM of each primer: CagA2 (5� ATT TAG AAG CAGGCT TTA GC 3�) and CMVin2 (5� GGT AGC ACC GCG GGT TTC GAC 3�) and 20 ng/µL of template DNA in termocycler GeneAmp PCR System 9600 (Perkin Elmer, USA). The thermal profile consisted of an initial denaturation step at 94°C for 2 minfollowed by 36 cycles of a 94°C denaturation for 30 sec, a 30°C annealing for 5 min, a 72°C elongation for 1 min, proceededwith 37 cycles of a 94°C denaturation for 30 s, a 30°C annealing for 1 min and a 72°C elongation for 2 min. At the end ofamplification mixture was subjected to the final extension at 72°C for 7 min. Amplified products including a negative control anda molecular weight marker (Mass RullerTM DNA Ladder, MBI Fermentas, Lithuania) were analyzed by electrophoresis in6% polyacrylamide gel stained with 0.5 mg/L ethidium bromide and visualized, photographed and analyzed by GelDoc 2000(BioRad Laboratories, USA). Dice coefficient was calculated and compared to evaluate similarity among strains by BIOGENEsoftware (Vilber Lourmat, France).

105Characteristic of hospital isolates of P. aeruginosa2

Results

The isolation sites of 90 strains P. aeruginosa for the 56 patients are shown in Table I. Most of strains(63�70%) were isolated from lower respiratory tract of patients admitted to ICU, 16 (17.8%) from postope-rative wounds and single from catheters (4), throat (4), bile (2) and anus (1). P. aeruginosa was isolatedfrom one site or from sequential samples of various respiratory tract exudates in 52 patients, and from twodifferent sites in 4 patients (in all from respiratory tract and wound-2, or catheter-1, or anus-1).

No1 ICU 1a 1 1c 1 5b 1 4b 4 16(15b,1f) 11b 1 3(2b,1c) 1 3(2b,1d) 1

3(2a,1b) 1 2b,g 13(2b,1d) 1 3b 33b 1 3d 24b 2 1g 1

11b 11Sur1 1d 1 2d 2

2g 2Sur2 1e 1 3d 3 2d 2DSur 2d 2 1d 1

N°2 ICU 2b 2 1b 11c 1

N°3 ICU 2(1a,1b) 11b 1

N°4 ICU 1b 1Sur 1e 1

Total 2 2 3 3 39 24 10 10 36 17

Table IIsolation site of 90 Pseudomonas aeruginosa from 56 patients hospitalized in 1996�2000

Hospital/ward1996 number

of strains patients1997 number




of strains patients

Isolation site: a � throat, b � bronchi, c � BAL, d � wound, e � bile, f � anus, g � catheter

Fig. 1. AP-PCR fingerprintints as representative of 11 main groups (A � K) and 5 unique profiles (P � O) obtained from90 isolates Pseudomonas aeruginosa. The lane M is a molecular weight marker (Mass Ruller TM DNA ladder, Fermantas)

Genetic types were determined based on cluster analysis comparing values of Dice coefficient for AP-PCRpatterns. Two main groups (I�II) at the level of 30�40% of Dice coefficient were observed. AP-PCR typingrevealed 11 groups of genotypes (A-K) containing from 2 to 20 isolates of a high similarity according toDice coefficient values (70�100%) and 5 unique isolates (L, M, N, O, P) (Fig. 1 and 2). Among them,genotypes persistently present in a particular ward for some years were detected, e.g. AP-PCR types A andD isolated from a ICU in the hospital no 1 from 1996 to1998, as well as strains typical of different wardsof the same hospital, e.g. AP-PCR type C (ICU, Sur1 and DSur) and type F (ICU, Sur1, Sur2, DSur). It was

M A B C D E F G H I J K P L M N O

1031900800700600500400300200100

89


Fig. 2. Dendrogram demonstrating the geneticrelationship among 90 isolates Pseudomonasaeruginosa. The scale corresponds to the per-centage of similarity. A � K AP-PCR types,P � O-uniqe types.


observed that some AP-PCR types occurred simultaneously for a year or longer in different hospitals,e.g. AP-PCR types H and K detected in 1997 (hospital no 2) and 1998 (hospitals nos 2�4). Details arepresented in Table II. Most often the same clones were isolated from two to ten patients, but the differentclones in sequential samples from respiratory tract or from two sites of the same patient were found also.

Strains classified to the same genotypic type were not phenotypically similar, i.e. they did not displaythe same susceptibility to antimicrobial agents and the same type of growth on selective medium as well asthey did not belong to the same serotype. Within the same type up to several resistance profiles, serotypesand types of growth on selective medium were presented. Detailed data on comparison of phenotypic andgenotypic strain features are presented in Table III.

Irrespectively of the hospital and/or ward, most of P. aeruginosa isolates showed very differentiatedresistance to antimicrobial agents tested. Different resistance patters in various arrangements were observed,from sensitivity to all tested antibiotics, through single resistance to carbenicillin or/and pefloxacin tomultidrug resistance for almost all tested drugs. All strains were susceptible to colistin. Strains isolatedin 1996 and 1997 and 4 from 5 unique types (L, M, N, P) were generally less resistant to chemotherapeuticagents than isolated since the end of 1998. Nevertheless, no correlation was found between susceptibilityto antibiotics and serotype or the type of growth on selective medium.

The total of 90 P. aeruginosa strains were tested on selective cetrimide agar. A green-yellow type ofgrowth appeared most frequently (59 strains � 65.5%) whereas a yellow type was the most rarely found(1.1%). Details are presented in Table III.

From all tested strains 81 isolates (89.9% of) reacted with applied sera. 11 serotypes were distinguished.Most strains (70�77.7%) typed by monovalent sera. Two serotypes: FO:11 (46�51.1%) and EO:16(17�18.9%) were observed most frequently. Individual strains reacted with following sera EO:15 (2), AO:1(1), AO:4 (2), AO:6 (1), CO:10 (1). Some strains were typed only by polyvalent sera: PMA (6), PME (3)and PMF (2) whereas 9 (10.0%) of strains was non-typed at all. In general, 21 of strains (23.3%) gaveambiguous typing results. A great variety of serotypes were observed among isolates from hospitals no 1and 2. Only all strains isolated from the hospital no 3 belonged exclusively to EO:16 serotype whereasisolates from the hospital no. 4 were identified as FO:11.

Discussion

The hospital environment remarkably promotes selection and quick distribution of resistant strains(Dzier¿anowska, 1997; Giedrys-Kalemba, 2000; Hanberger et al., 2004; Jaworski et al., 1993; £opaciuk,1996; Sader et al., 2004). One of the essential steps leading to a reduction of nosocomial infectionsis a constant monitoring of etiological agents and resistance of intrahospital strains. It is of crucial impor-tance to carry out epidemiological surveys including a detailed characteristic and relationship amongstrains isolated in particular environment and time, as well as to become aware of risk factors, sourcesand ways of infection distribution (Czekaj³o-Ko³odziej, 2001; £opaciuk, 1996). To obtain reliable results,

N°1 ICU A (1), D (1) D (1) A (4), D (3), E (5), B (2), E (1), M (1) C (4), F (15), J (8),G (12), I (7), L (1) O (1)

Sur1 C (1) F (3), J (1)Sur2 G (1) E (2), N (1) F (1), J (1)DSur C (2) F (1)

N°2 ICU H (1),K (1) K (2)

N°3 ICU H (3)

N°4 ICU H (1)Sur P(1)

Table IIAP-PCR types of Pseudomonas aeruginosa isolated in the north-west region of Poland

Hospital/wardAP-PCR type (number of strains)

1996 1997 1998 1999 2000

ICU � Intensive Care Unit, Sur � General Surgery, Sur1 � General and Vascular Surgery, Sur2 � General and Transplantation Surgery,DSur � Maxillofacial and Dental Surgery

108C

zekaj³o-Ko³odziej U

. et al.2

A CbTzpPef 1996 1 green-yellow (4)CbGnTbPef 1997 1 1 1 1 green (1)

B CbTzpGnTbAkPefCip 1999 2 green-yellow (2)

Cb 1999 2 celadan (3)CbGnTbNetAkPefCip 1999 1 green-yellow (2)

C TzpGnTbNetPefCip 2000 1 green (1)CbTzpIpmMemGnTbNetAkPefCip 2000 1 blue-green (1)CbTzpGnTbNetAkPefCip 2000 2

CbTzpCazGnTbNetPef 1996 1D MemGnTbNetAkPefCip 1997 1 green-yellow (5)

CbMemGnTbPef 1998 3

CbTzpMemGnTbAk 1998 1CbTzpIpmGnTb 1998 1CbTzpCazIpmMemGnTbAk 1998 1 green-yellow (5)

E CbTzpGnTbPefCip 1998 1 blue-green (2)CbTzpImpGeTbPrfCip 1998 1 green (1)CbTzpGnTbAkPefCip 1999 2sensitive to all 1999 1

CbTzpIpmGnTbNetAkPefCip 1999 1CbPef 1999 1Cb 1999 1 1 1CbMemPef 1999 1CbTzpMemGnTbNetAkPef 1999 2CbTzpCazIpmMemGnTbNetAkPefCip 1999 1 green-yellow (9)Caz 1999 1 green (9)

F CazTzpTbNetAkPefCip 1999 1 yellow (1)CbIpmMemGn 1999 1 celadan (1)CbTzbCazMemGnTbAkNetPef 1999 1CbCazMemGnTbAkPefCip 1999 1CbTzpMemGnTbNetAkPefCip 1999 1 1CbTzpIpmMemGeTbNetAkPef 1999 2CbImp 1999 1CbTzpImpMemGrTbNetAkPefCip 1999 1

Table IIIAP-PCR types Pseudomonas aeruginosa isolated in the north � west region of Poland and their phenotypic differentiation

AP-PCRtype

Resistance pattern Date ofisolation

Serotype Type of growthon Cetrimide AgarNTPMFPMEPMACO:10AO:6AO:4AO:1EO:15EO:16FO:11

109C

haracteristic of hospital isolates of P. aeruginosa2

Cb � carbenicillin, Tzp � piperacillin-tazobactam, Caz � ceftazidime, Imp � imipenem, Mem � meropenem, Ge � gentamicin, Tb � tobramycin, Net � netilmicin, Ak � amikacin, Pef � pefloxacin, I � intermediate

CbIpmTbPefCip 1998 2CbTzpIpmMemGnTbAkPefCip 1998 2CbMemGnTbPef 1998 2CbGnTbPefCip 1998 1CbGnAkPefCip 1998 1 green-yellow (12)

G NetPefCip 1998 1 blue-green (1)GnNetPefCip 1998 1CbGnTbAkPefCip 1998 1CbIpmMemGnTbAkPefCip 1998 1Pef(I) 1998 1

sensitive to all 1997 1

HCbTzpGnTbNetPefCip 1998 2 green-yellow (5)CbTzpGnTbNetAkPefCip 1998 1CbTzpPefCip 1998 1

CbPef 1998 1 green-yellow (6)I CbGnTbPefCip 1998 1 blue-yellow (1)

CbCazGnTbNetAkPefCip 1998 3 1 1

CbTzpIpmMemGnTbNetAkPef 2000 1CbTzpTbNetPef 2000 1CbTbNetPef 2000 1 green (5)

JCbTzpMemGnTbNetPefCip 2000 1 green-yellow (3)CbTzpMemGnTbNetPef 2000 1 1 celadan (2)CbTzpCazImpMemGnTbNetAkPefCip 2000 2CbTzbGeTbNetPef 2000 1CbTzpCazGeTbNetAkPefCip 2000 1

CbPef 1997 1K CbTzpGnTbNetPef 1998 1 green-yellow (3)

GnTbPef 1998 1

L Pef(I) 1998 1 green

M Pef 1999 1 green-yellow

N Pef(I) 1999 1 green-yellow

O CbTzpCazImpMemGeTbNetAkPef 2000 1 green-yellow

P CbPefCip 2000 1 green

Table III continued

AP-PCRtype

Resistance pattern Date ofisolation

Serotype Type of growthon Cetrimide AgarNTPMFPMEPMACO:10AO:6AO:4AO:1EO:15EO:16FO:11


especially in case of isolates without characteristic phenotypic markers, application of molecular methodsseems to be inevitable.

To differentiate precisely among particular P. aeruginosa strains isolated from 4 hospitals in the west-north region of Poland, AP-PCR typing was carried out. However, due to the large number of strains andtheir different origin, the classification of strains/genetic patterns was conducted at the level of 70% andmore of Dice coefficient (Struelens et al., 1993). Dendrogram analysis enabled to divide strains into maingroups (40�50% of similarity), then subgroups (55�65%), genotypes (70�75%) and subtypes (76�100%).AP-PCR typing revealed presence of 16 AP-PCR types of P. aeruginosa.

A high number of AP-PCR types pointed to marked intrahospital differentiation of P. aeruginosa strainsthat are widely distributed in nature, especially in humid environments. It indicated various sources ofstrains and their constant exchange, also with the same patients. Such strains were generally highly resistantto antibiotics what confirmed the development of secondary resistance and their intrahospital selection.At the same time strains of unique fingerprints, frequently expressing higher susceptibility to chemothera-peutic agents, were isolated. It gave evidence of the temporary incidence of new endogenous strains enteringthe hospital environment.

Some of the genetic types expressing the same/similar of AP-PCR pattern were numerically dominantwithin the ward(s) for some months/years. It might prove horizontal transmission of clones or clonally-relatedgroups and epidemic/endemic character of registered infections (Fiett et al., 1998). The incidence of thesame genetic types of P. aeruginosa in different hospitals drew attention to a possibility of a long-distancestrain transmission. It might be linked to the movement of patients, visitors, medical and paramedical staff.

Based on dates of strains isolation and their resistance to antibiotics, it is highly probable that selectionof highly resistant isolates takes place in ICUs, where P. aeruginosa is one of the most frequent and severecause of infections, especially in patients with mechanical ventilator. In the absence of epidemic clones,secondary resistance development during combined antibacterial therapy appeared to be the main factorcontributing to the prevalence of resistance in ICU, what was observed in sequential samples from the samepatient. On the other side, the significance of patients relocated from different wards to ICUs and colonizedwith ward-specific microflora should not be underestimated.

Phenotypic methods are based on a presence or absence of expressed and strain characteristic features.Instability of such features in various environmental conditions is the main disadvantage of phenotypicassays that frequently precludes a precise strain characteristic. Types of P. aeruginosa growth on CetrimideAgar medium differed significantly within strains belonging to one genotype as well as among strains ofdifferent genotypes. The green-yellow type was observed most frequently (65.6%) whereas the yellow typewas the rarest (1.1%). Also serotyping based on the somatic antigen evaluation according to Habs protocoldid not reveal correlation between genotypes and serotypes. Both FO:11 (51.1%) and EO:16 (18.9%) werethe most widespread serotypes. The FO:11 serotype was isolated from almost all wards in hospitals coveredby our studies. Intriguingly, a FO:12 serotype (the dominant type among multi-resistant P. aeruginosa strainsin the hospitals all over the world) was not detected (Bingen, et al., 1996; Cavallo et al., 2000). Serotypingis not considered as the method of high discriminatory power. The occurrence of antigenic variations withinstrains causes that some strains do not respond to commercial sera (10.0% of strains analyzed in our studies).A susceptibility to antibiotics is not also the most practical tool for unambiguous epidemiological evalua-tion of strains. However, it may serve as the preliminary criterion indicating the incidence of a potentialintrahospital strain and signaling the necessity of conducting further investigations.

Results of AP-PCR typing did not reveal consistence between strain fingerprints and their phenotypicfeatures. A majority of P. aeruginosa strains presented a high differentiation of phenotypic patterns withina genotype. It confirmed lack of correlation between molecular and conventional typing, e.g.: typesof growth on Cetrimide Agar, serotype or susceptibility/resistance pattern to antimicrobial agents. Similarresults also with the other genera of microorganisms were proved (Bouza et al., 1999; Fierobe et al., 2001;Dinesh et al. 2003; Giedrys-Kalemba et al., 2001). The lack of correlation between P. aeruginosa AP-PCRtypes and their phenotypic features indicates that phenotypic analysis should not be exclusive methodof evaluating of strain relationship and conducting epidemiological investigations of nosocomial infections.It is necessary to carry out analysis at the molecular level (Cavallo et al., 2000; Gomez et al., 2000).However, phenotypic studies are a valuable tool supplementing genotyping as they enable tracing of pheno-typic feature expression influenced by different environmental conditions (Biendo et al., 1999).


Literature

A y a t s J., X. C o r b e l l a, C. A r d a n u y, M.A. D o m i n g u e z, A. R i c a r t, J. A r i z a, R. M a r t i n and J. L i n a r e s.1997. Epidemiological significance of cutaneous, pharyngeal, and digestive tract colonization by multiresistant Acinetobacterbaumannii in ICU patients. J. Hosp. Infect. 37: 287�295.

B e r t r a n d X., P. B a i l l y, G. B l a s c o, P. B a v a y, A. B o i l l o t and D. T a l o n. 2000. Large outbreak in a surgical inten-sive care unit colonization or infection with Pseudomonas aeruginosa that overexpressed an active efflux pump. Clin. Infect.Dis. 31: 9�14.

B i e n d o M., G. L a u r a n s, J.F. L e f e b v r e, F. D a o u d i and F. E b. 1999. Epidemiological study of an Acinetobacterbaumannii outbreak by using a combination of antibiotyping and ribotyping. J. Clin. Microbiol. 37: 2170�2175.

B i n g e n E., S. B o n a c o r s i, P. R o h r l i c h, M. D u v a l, S. L h o p i t a l, N. B r a h i m i, E. V i l m e r and R.V. G o e r i n g.1996. Molecular epidemiology provides evidence of genotypic heterogeneity of miltidrug-resistant Pseudomonas aeruginosaserotype O:12 outbreak isolates from a pediatric hospital. J. Clin. Microbiol. 12: 3226�3229.

B o d d i e D.E., D.G. C u r r i e, O. E r e m i n and D.S. H e y s. 2003. Immune suppression and isolated severe head injury:a significant clinical problem. Brit. J. Neurosurg. 17: 405�417.

B o u z a E., F. G a r c i a - G a r r o t e, E. C e r c e n a d o, M. M a r i n and M.S. D i a z. 1999. Pseudomonas aeruginosa:a survery of resistance in 136 hospitals in Spain. The Spanish Pseudomonas aeruginosa study grup. Antimicrob. AgentsChemother. 43: 981�982.

C a v a l l o J.D., F. L e b l a n c and R. F a b r e. 2000. Surveillance of Pseudomonas aeruginosa sensitivity to antibiotics in Franceand distribution of beta-lactam resistance mechanisms: 1998 GERPB study. Pathol. Biol. 48: 472�477.

C o b b B.D. and J.M. C l a r k s o n. 1992. Optimization of RAPD fingerprinting. In: M.R. Micheli, R. Bova (eds), Fingerprintingmethods based on arbitrarily primed PCR. New York: Springer-Verlag. 93�102.

C z e k a j ³ o - K o ³ o d z i e j U. 2001. Phenotypic and genotypic characteristics of Pseudomonas aeruginosa i Acinetobacterbaumannii isolated from hospitals in Szczecin (in Polish). Zaka¿enia 1: 35�37.

D i n e s h S.D., H. G r u n d m a n n, T.L. P i t t and U. R o m l i n g. 2003. European-wide distribution of Pseudomonasaeruginosa clone C. Clin. Microbiol. Infect. 9: 1228�1233.

D z i e r ¿ a n o w s k a D. 1997. Antibiotic-resistant bacteria in hospital (in Polish). Nowa Med. 16: 18�24.F i e r o b e L., J.C. L u c e t, D. D e c r e, C. M u l l e r - S e r i e y s, A. D e l e u z e, M.L. J o l y - G u i l l o u, J. M a n t z and

J.M. D e s m o n t s. 2001. An outbreak of imipenem-resistant Acinetobacter baumannii in critically ill surgical patients.Infect. Control Hosp. Epidem. 22: 35�40.

F i e t t J., K. T r z c i ñ s k i, W. H r y n i e w i c z and M. G n i a d k o w s k i. 1998. The application of molecular biology methodsin epidemiological typing of Pseudomonas aeruginosa isolated from hospital outbreak (in Polish). Przeg. Epidem. 52: 427�441.

G a r c i a - G a r m e n d i a J.L., C. O r t i z - L e y b a, J. G a r n a c h o - M o n t e r o, F.J. J i m e n e z - J i m e n e z, J. M o n t e r r u b i o -V i l l a r and M. G i l i - M i n e r. 1999. Mortality and the increase in length of stay attributable to the acquisition ofAcinetobacter in critically ill patients. Crit. Care Med. 27: 1794�1799.

G a r r o u s t e - O r g e a s M., O. M a r i e, M. R o u v e a u, S. V i l l i e r s, G. A r l e t and B. S c h l e m m e r. 1996. Secondarycarriage with multi-resistant Acinetobacter baumannii and Klebsiella pneumoniae in an adult ICU population: relationshipwith nosocomial infections and mortality. J. Hosp. Infect. 34: 279�289.

G i e d r y s - K a l e m b a S. 2000. Antibiotic-resistance of bacteria isolated in the north-west region of Poland (in Polish). Przegl.Epidemiol. 54: 45�56.

G i e d r y s - K a l e m b a S., I. B i l s k a, T. N i k o d e m s k i, R. B o h a t y r e w i c z and A. K a c z m a r e k. 2001. Micro-biological assessment of materials from respiratory tract in patients requiring mechanical ventilation (in Polish). Zaka¿enia1: 44�45.

G i l l e s p i e T.A., P.R.E. J o h n s o n, A.W. N o t m a n, J.E. C o i a and M.F. H a n s o n. 2000. Eradication of resistantPseudomonas aeruginosa strain after a cluster of infections in hematology/oncology unit. Clin. Microbiol. Infect. 6: 125�130.

G o m e z P.J.C, W.L. P e d r e i r a J r., E.M. A r a u j o, F.G. S o r i a n o, E.M.A. N e g r i, L. T o n a n g e l o and I. T a d e uVe l a s c o. 2000. Impact of BAL in the management of pneumonia with treatment failure: positivity of BAL culture underantibiotic therapy. Chest 118: 1739�1746.

G o s p o d a r e k E. and B. W a s z a k. 1995. Prevention against hospital outbreaks (in Polish). Med. 51/52: 10�13.H a b s I. 1957. Untersuchungen uber die O-Antigene von Pseudomonas aeruginosa. Zeitschr Hygiene 144: 218�228.H a n b e r g e r H., M. E r l a n d s s o n, L.G. B u r m a n, O. C a r s, H. G i l l, S. L i n d g r e n, L.E. N i l s s o n, B. O l s s o n -

L i l j e q u i s t, S. W a l t e r and I C U - S T R A M A S t u d y G r o u p. 2004. High antibiotic susceptibility among bac-terial pathogens in Swedish ICUs. Report from a nation-wide surveillance program using TA90 as a novel index of suscepti-bility. Scand. J. Infect. Dis. 36: 24�30.

H a n c o c k R.E.W., L.M. M u t h a r i a, L. C h a i n, R.P. D a r v e a u, D.P. S p e e r t and G.B. P i e r. 1983. Pseudomonasaeruginosa isolates from patients with cystic fibrosis: a class of serum-sensitive, nontypable strains deficient in lipopolysac-charide O side chains. Infect. Immun. 42: 170�177.

J a w o r s k i A., P. S t ¹ c z e k. 1993. Variability of bacterial genome (in Polish). Post. Mikrobiol. 32: 113�156.K a n g C.I., S.H. K i m, S.H. K i m, H.B. K i m, S.W. P a r k, Y.J. C h o e, M.D. O h, E.C. K i m and K.W. C h o e. 2003.

Pseudomonas aeruginosa bacteremia: risk factors for mortality and influence of delayed receipt of effective antimicrobialtherapy on clinical outcome. Clin. Infect. Dis. 37: 745�747.

K e r s u l y t e D., M.J. S t r u e l e n s, A. D e p l a n o and D.E. B e r g. 1995. Comparision of arbitrarily primed PCR and macro-restriction (Pulsed-Field Gel Electroforesis) typing of Pseudomonas aeruginosa strains from cystic fibrosis patients. J. Clin.Microbiol. 33: 2216�2219.

£ o p a c i u k U. 1996. Strategies for limitation of resistant strains number (in Polish). Antybiotykoterapia i Choroby Infekcyjne3: 621�624.


N i k o d e m s k i T. 1997. Ph.D. thesis. Pomeranian Medical University, SzczecinP e a c o c k S.J. and C.S. G a r r a r d. 1997. The challenge of Pseudomonas aeruginosa pneumonia. Yearbook of Intensive Care

and Emergency Medicine 1997. Berlin-Heidelberg: Springer-Verlag. 607�624.Performance standards for antimicrobial susceptibility testing. Ninth Informational Supplement. January 1999. NCCLS M100-S8;

M100-S9.P i o t r o w s k a B. 1998. Pneumonia (in Polish). Nowa Klinika 5: 59�63.P o w e r E.G.M. 1996. RAPD typing in microbiology � a technical review. J. Hosp. Infect. 34: 247�265.S a d e r H., M. C a s t a n h e i r a, R.E. M e n d e s, M. T o l e m a n, T.R. W a l s h and R.N. J o n e s. 2005. Dissemination and

diversity of metallo-ß-lactamases in Latin America: report from the SENTRY Antimicrobial Surveillance Program. Int.J. Antimicrobiol. Agent 25: 57�61.

S p e n c e r R.C. 1993. Nosocomial infection in the intensive care unit: a question of surveillance. Int. Care World 10: 173�176.S t r u e l e n e s M.J., V. S c h w a m, A. D e p l a n o and D. B a r a n. 1993. Genome macrorestriction analysis of diversity and

variability of Pseudomonas aeruginosa strains infecting cystic fibriosis patients. J. Clin. Microbiol. 31: 2320�2326.T a g u c h i G. and Y. W u. 1980. Introduction to off-line quality control. Nagoya: Japan Quality Control Organization.v a n B e l k u m A. 1994. DNA fingerprinting of medically important microorganisms by use of PCR. Clin. Microbiol. Rev. 7:

174�184.Ve r s a l o v i c J., C.R. W o o d s, P.R. G e o r g h i o u, R.J. H a m i l l and J.R L u p s k i. 1993. DNA-based identification and

epidemiologic typing of bacterial pathogens. Arch. Pathol. Lab. Med. 117: 1088�1098.


Detection of Enterotoxic Bacillus cereus Producing Hemolyticand Non Hemolytic Enterotoxins by PCR Test

EL¯BIETA O£TUSZAK-WALCZAK*, PIOTR WALCZAK and ROBERT MODRAK

Institute of Fermentation Technology and Microbiology, Technical University of £ód�,Wólczañska 171/173, 90-924 £ód�, Poland

Received 18 October 2005, revised 20 December 2005, accepted 21 December 2005

This article is devoted to the memory of the late Prof. W.J.H. Kunicki-Goldfingeron the tenth anniversary of his passing away

A b s t r a c t

Nine strains belonging to Bacillus cereus group has been isolated from food and environmental samples. Theirtaxonomic position was confirmed by RFLP analysis of 16S rRNA gene digested with TaqI. The detection of DNAsequences encoding the hemolysin BL complex and enterotoxin NHE, was studied in Bacillus sp. isolates. Set of primerswas used to amplify fragment of hblD gene by PCR. For the detection of nheB gene a new primer set was developedwhich allowed to amplify 273 bp fragment from wide number of strains belonging to B. cereus group. The hblD genewas present in 7 out of 9 isolates whereas nheB gene occurred in all of them. Reference strains of B. cereus £OCK0807, and B. thuringiensis NCAIM 01262 contained both genes. Strains of B. subtilis ATCC 6633 and B. pumilusLOCK 0814 do not contain both genes. Obtained results showed that B. thuringiensis NCAIM 01262 contains bothgenes and therefore may be harmful for human beings.

K e y w o r d s: enterotoxin BL, enterotoxin NHE, Bacillus cereus group, PCR

Introduction

Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis are members of the Bacillus cereus groupof bacteria sharing common properties and strong genetic similarity especially in the sequence of 16S rRNA,the number of rRNA operons, their organization, localization and ability to produce numerous toxins respon-sible for pathogenicity and food poisonings. B. anthracis causes the acute fatal disease, anthrax, and iswidely recognised as powerful biological weapon due to its high toxicity for human beings. B. thuringiensisis a well known producer of crystalline intracellular proteins called *-endotoxins, toxic to wide number ofinsect larvae belonging to Diptera and Coeloptera. For this reason cells of B. thuringiensis are widely usedas biological pesticide and its genes coding for *-endotoxins were used for the construction of pest resistanttransgenic crop plants. B. cereus is a very common soil bacterium which may contaminate starchy foodproducts and raw materials causing diarheal and emetic food poisonings. Formation of thermoresistant sporesby Bacillus cereus may also cause sterility problems in ready to eat dishes consisting of boiled rice, noodles,potato and other starch-containing food products.

Advent of modern genetics brought a lot of information on chromosome organization of the members ofB. cereus group. So far two B. anthracis strains Ames and Sterne (Read et al., 2003; Brettin et al., 2004c),three B. cereus strains ATCC 14579 (Ivanova et al., 2003), ATCC 10987 (Rasko et al., 2004) and ZK(Brettin et al., 2004b) as well as one B. thuringiensis serovar konkukian strain 97�27 (Brettin et al., 2004a)were sequenced and the data obtained were disseminated to the public through computer databases. This

* Corresponding author. Mailing address: Institute of Fermentation Technology and Microbiology, Technical University of£ód�, Wólczañska 171/173, 90-924 £ód�, Poland. e-mail address: [email protected]

114 O³tuszak E. et al. 2

makes ideal situation for comparative genomics in silico to study distribution of disease related genes in allmembers of that group. From the viewpoint of food poisonings caused by B. cereus, presence of two geneclusters responsible for the production of hemolytic HBL and nonhemolytic NHE enterotoxins are veryimportant. Search of computer databases revealed presence of non hemolytic enterotoxin gene clusternheABC in all sequenced members of B. cereus group showing that even recognized as �non toxic�B. thuringiensis serovar konkukian str 97�27 can cause food poisonings. Gene cluster responsible for theproduction of hemolysin BL hblCDA was found only in one strain of B. cereus ATCC 14579 and inB. thuringiensis serovar konkukian str 97�27. This findings also confirmed possible toxicity of strain knownas �harmless�. Therefore detection of enterotoxin production potential of strains belonging to the B. cereusgroup is very important for the epidemiology of food poisonings. Available methods of detectionof enterotoxic B. cereus group were as follows: 1 � blood cell hemolysis on Columbia Agar medium,2 � immunological tests, Bacillus diarrheal enterotoxin visual immunoassay (BDE kit Tecra), (BCET-RPLAkit Oxoid), 3 � PCR test. The B. cereus enterotoxin test kit RPLA, Oxoid is specific to the L2 componentof the hemolysin BL complex whereas BDE kit Tecra detects two non toxic proteins of 40 and 41 kDacharacteristic to enterotoxic strains (Beecher and Wong, 1994). Detection of both enterotoxins with PCRbased technique has been developed by Hansen and Hendriksen (2001) who proposed sets of primers forindividual genes of hblCDA and nheABC operons. Mantynen and Lindstrom (1998) and Neil et al. (2003)used PCR technique for detection of hblCDA operons. Comparison of immunological methods for detectionof enterotoxin producing strains with PCR-based technique showed good correlation of obtained results andtherefore both techniques can be equally reliable and repleaceable (Mantynen and Lindstrom, 1998). Theseauthors have also shown that presence of enterotoxin coding genes are not characteristic for the genusB. cereus but also can be found in Bacillus mycoides, Bacillus pasteurii, Bacillus smithii and Bacillusthuringiensis. However among 50 strains of B. cereus, only 26 contained enterotoxin coding genes suggestingthat this feature is strain specific. Presence of enterotoxin genes in non cereus group, Bacillus pasteurii andBacillus smithii, may indicate that ability to produce the same enterotoxins can be found in other speciesbelonging to the genera Bacillus.

The aim of the present study was to develop rapid and accurate diagnostic tests for detecting Bacilluscereus group genes responsible for the production of enterotoxins. In order to determine phylogenetic posi-tion of studied strains we performed 16S rRNA gene RFLP analysis.

Experimental


Bacterial strains used in this study. Bacterial strains applied in this study (Bacillus sp. 1 � sp. 9) were isolated from differentfood products according to the method described in the PN-EN ISO 7132 using MYP selective medium (Oxoid). B. cereus £OCK0807, B. thuringiensis NCAIM 01262, B. pumilus £OCK 0814 and B. subtilis ATCC 6633 were used as reference strains. Theyoriginated from Culture Collection of the Institute of Fermentation Technology and Microbiology, Technical University of £ód�.

DNA preparation. Chromosomal DNA was isolated according to the modified method of Marmur (1961). Additional lysozymetreatment of digested cell suspension with proteinase K was the major modification of original method.

PCR amplification of 16S rRNA, hblD and nheB fragments. Primer sequences for amplification of hblD, nheB and 16S rRNAfragments were derived from data records published in NCBI Database (Table I). Amplification of hblD fragment (430 bp) wasperformed in the following manner. About 20 ng of DNA template, 20 pmol of primer hblDF, 20 pmol of primer hblDR, 12.5 µlRed-Taq ReadyMix DNA polymerase (Sigma-Aldrich) were mixed together and supplemented with PCR grade water to a totalvolume of 25 ml. The amplification procedure consisted of one cycle of 2 min at 94°C, followed by 35 cycles for 30 sec at 94°C,

16S rRNA FRNA 5�-AGAGTTTGATCCTGGCTCAGGA-3� AE016877RRNA 5�-GGAGGTGATCCAGCCGC-3�

hblD hblDF 5�-AATCAAGAGCTGTCACGAAT-3� Hansen and Hendriksen (2001)hblDR 5�-CACCAATTGACCATGCTAAT-3�

nheB nheBF 5�-ATGACAAAAAAACCTTATAAAGTAATG-3� This worknheBR 5�-ATTTCCAAAGTTAACATTACCTTGT-3�

Table IPrimers used for PCR amplification of 16S-rRNA, hblD, nheB fragments

DNAsequence Name Primer Sequence source

115Differentiation of enterotoxic B. cereus by PCR test2

30 sec at 48°C and 90 sec at 72°C with final extension cycle for 2 min at 72°C was performed using Uno II thermocycler, Biometra,with tube lid heating block set for 105°C. No overlay oil was added to the tubes. The reaction mix for amplification of nheBfragment (273 bp) was the same except of primers replaced by nheBF and nheBR in the concentration of 20 pmol each. Theamplification procedure for nheB fragment consisted of one cycle of 2 min at 94°C, followed by 35 cycles for 30 sec at 94°C, 30 secat 50°C and 90 sec at 72°C with final extension cycle for 2 min at 72°C. In case of 16S rRNA gene amplification the reaction mixwas the same but primers were replaced by FRNA and RRNA in the concentration of 20 pmol each. The amplification procedurefor 16S rRNA fragment consisted of one cycle of 2 min at 94°C, followed by 35 cycles for 1 min at 94°C, 1 min at 55°C and 3 minat 72°C with final extension cycle for 2 min at 72°C.

RFLP analysis. The 16S rRNA amplification fragments were digested with TaqI (MBI Fermentas) for 1 h at 65°C according tothe product instruction. The digested PCR products were run at 60V for 4 h in 2% (w/v) agarose gel (0.5 TBE buffer containing0.5 µg/ml ethidium bromide by using gel electrophoresis apparatus (Biotec Fisher). Gells placed on UV transiluminator werephotographed with digital camera through yellow filter.

Agarose gel analysis of PCR products. PCR products of hblD and nheA fragments after amplification were analysed on 1%(w/v) agarose gel in 0.5 TBE buffer containing 0.5 µg/ml ethidium bromide. Gels were run at 60 V for 3 h and photographed asdescribed above.

Results and Discussion

RFLP analysis of 16S rRNA amplicons of bacterial isolates and reference strains (Fig. 1) confirmedprevious findings from classical diagnostic procedure (PN-EN ISO 7132) that all Bacillus sp. 1�9 isolatesbelongs to the cereus group. Profile comparison of lane 1 and 2 in Fig. 1 showed that RFLP patterns for the

Fig. 1. RFLP profiles of 16S rRNA gene amplicons digested with TaqI.W � DNA size marker; lanes 1� B. thuringiensis NCAIM 01262; 2 � B. cereus £OCK 0807; 3 � B. subtilis ATCC 6633;

4 � B. pumilus £OCK 0814; 5 � Bacillus sp. 1; 6 � Bacillus sp. 2; 7 � Bacillus sp. 3; 8 � Bacillus sp. 4; 9 � Bacillus sp. 5;10 � Bacillus sp. 6; 11 � Bacillus sp. 7; 12 � Bacillus sp. 8; 13 � Bacillus sp. 9.

Fig. 2. Electrophoregram of hblD gene fragment amplicons.W � DNA size marker; lanes 1 � B. thuringiensis NCAIM 01262; 2 � B. cereus £OCK 0807; 3 � B. subtilis ATCC 6633;

4 � B. pumilus £OCK 0814; 5 � Bacillus sp. 1; 6 � Bacillus sp. 2; 7 � Bacillus sp. 3; 8 � Bacillus sp. 4;9 � Bacillus sp. 5; 10 � Bacillus sp. 6; 11 � Bacillus sp. 7; 12 � Bacillus sp. 8; 13 � Bacillus sp. 9.


reference strains B. thuringiensis NCAIM 01262 and B. cereus £OCK 0807 are the same and therefore,these species can not be distinguish with this method. This finding has been confirmed by computer analysisof published sequences of 16S rRNA genes from all four members of cereus group (B. anthracis, B. cereus,B. mycoides, B. thuringiensis), showing that TaqI recognition sites within the region of that gene resides at63, 201 and 972 bp positions. Taking into account that amplified fragment is 7 bp shorter from the front and

1 50nheB_B_anth_Ames (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTTTCAGCACTTATGGCAGT

nheB_B_anth_Sterne (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTTTCAGCACTTATGGCAGTnheB_B_cer_ATCC10987 (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTATCAGCACTTATGGCAGTnheB_B_cer_ATCC14579 (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTATCAGCACTGATGGCAGT

nheB_B_cer_ZK (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTATCAGCACTTATGGCAGT nheB_B_thu (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTATCAGCACTTATGGCAGT

Consensus (1) ATGACAAAAAAACCTTATAAAGTAATGGCTCTATCAGCACTTATGGCAGT51 100

nheB_B_anth_Ames (51) ATTTGCAGCAGGGAATATTATGCCGGCCCATACGTATGCAGCTGAAAGTAnheB_B_anth_Sterne (51) ATTTGCAGCAGGGAATATTATGCCGGCCCATACGTATGCAGCTGAAAGTA

nheB_B_cer_ATCC10987 (51) ATTTGCAGCAGGAAATATCATGCCGGCTCATACGTATGCAGCGGAGAGTAnheB_B_cer_ATCC14579 (51) ATTTGCAGCAGGAAATATTATGCCGGCTCATACGTATGCAGCTGAAAGTA

nheB_B_cer_ZK (51) ATTTGCAGCAGGGAATATTATGCCGGCCCATACGTATGCAGCTGAAAGTAnheB_B_thu (51) ATTTGCGGCAGGGAATATTATGCCGACCCATACGTATGCAGCTGAAAGTA

Consensus (51) ATTTGCAGCAGGGAATATTATGCCGGCCCATACGTATGCAGCTGAAAGTA101 150

nheB_B_anth_Ames (101) CTGTGAAACAAGCTCCAGTTCATGCGGTAGCAAAAGCTTATAATGACTATnheB_B_anth_Sterne (101) CTGTGAAACAAGCTCCAGTTCATGCGGTAGCAAAAGCTTATAATGACTAT

nheB_B_cer_ATCC10987 (101) CAGTGAAGCAAGCTCCAGTTCATGCGGCCGCAAAAGCTTATAATGATTATnheB_B_cer_ATCC14579 (101) CAGTGAAACAAGCTCCAGTTCATGCGGTAGCAAAAGCTTATAATGACTAT

nheB_B_cer_ZK (101) CAGTGAAACAAGCTCCCGTACATGCGGTCGCAAAAGCTTATAATGACTATnheB_B_thu (101) CAGTGAAACAAGCTCCAGTTCATGCGGTCGCAAAAGCTTATAATGACTAT

Consensus (101) CAGTGAAACAAGCTCCAGTTCATGCGGTCGCAAAAGCTTATAATGACTAT151 200

nheB_B_anth_Ames (151) GAAGAATACTCATTAGGACCAGAAGGCTTAAAAGATGCAATGGAAAGAACnheB_B_anth_Sterne (151) GAAGAATACTCATTAGGACCAGAAGGCTTAAAAGATGCAATGGAAAGAAC

nheB_B_cer_ATCC10987 (151) GAGGAATATTCATTAGGACCAGAAGGCCTAAAAGATGCAATGGAAAGAACnheB_B_cer_ATCC14579 (151) GAAGAATACTCATTAGGACCAGAAGGCTTGAAAGATGCAATGGAAAGAAC

nheB_B_cer_ZK (151) GAAGAATACTCATTAGGACCAGAAGGCTTAAAAGATGCAATGGAAAGAACnheB_B_thu (151) GAAGAATACTCATTAGGACCAGAAGGCCTAAAAGATGCTATGGAAAGAAC

Consensus (151) GAAGAATACTCATTAGGACCAGAAGGCTTAAAAGATGCAATGGAAAGAAC201 250

nheB_B_anth_Ames (201) AGGTTCAAACGCTTTAGTAATGGATCTGTATGCTTTAACAATCATTAAACnheB_B_anth_Sterne (201) AGGTTCAAACGCTTTAGTAATGGATCTGTATGCTTTAACAATCATTAAAC

nheB_B_cer_ATCC10987 (201) GGGTTCAAACGCTTTAGTAATGGATCTGTACGCTTTAACAATTATTAAACnheB_B_cer_ATCC14579 (201) AGGTTCAAATGCTTTAGTAATGGATCTGTACGCTTTAACAATTATTAAAC

nheB_B_cer_ZK (201) AGGTTCAAACGCTTTAGTAATGGATCTGTATGCTTTAACAATCATTAAACnheB_B_thu (201) AGGTTCAAACGCTTTAGTAATGGATCTGTATGCTTTAACAATCATTAAAC

Consensus (201) AGGTTCAAACGCTTTAGTAATGGATCTGTATGCTTTAACAATCATTAAAC251 273

nheB_B_anth_Ames (251) AAGGTAATGTTAACTTTGGAAATnheB_B_anth_Sterne (251) AAGGTAATGTTAACTTTGGAAAT

nheB_B_cer_ATCC10987 (251) AAGGTAATGTTAACTTTGGAAATnheB_B_cer_ATCC14579 (251) AAGGTAATGTTAACTTTGGAAAT

nheB_B_cer_ZK (251) AAGGTAATGTTAACTTTGGAAATnheB_B_thu (251) AAGGTAATGTTAACTTTGGAAAT

Consensus (251) AAGGTAATGTTAACTTTGGAAAT

Fig. 3. Alignment of 273 bp long fragment of nheB DNA sequence from fully sequenced chromosomes of B. anthracis strain Ames(AE016879). B. anthracis strain Sterne (AE017225), B. cereus ATCC 10987 (AE017994), B. cereus ATCC 14579 (AE016877),B. cereus ZK (CP000001) and B. thuringiensis serovar konkukian strain 97� 27 (AE017355). Underlined sequences represents

universal primers designed in this work for detection of nheB gene.

117Differentiation of enterotoxic B. cereus by PCR test2

4 bp from the end of complete 16S rRNA gene, resulting TaqI digestion products should have the followingsize: 56, 138, 579, 771 bp. Obtained results confirmed usefulness of applied RFLP analysis for geneticconfirmation of taxonomic position of isolated strains.

Application of primers developed by Hansen and Hendriksen (2001) allowed to dectect hblD gene(Fig. 2). The obtained results showed that in seven isolates of Bacillus sp. 1�3 and sp. 4�8 as well as inboth reference strains B. thuringiensis NCAIM 01262 and B. cereus £OCK 0807 this gene was present.Strains of Bacillus sp. 4 and 9 showed presence of hblD related bands (430 bp) with very low intensity whatmay be interpreted as lack of this gene. However this result can be obtained because the incompatibility ofprimers with the polymorphic DNA of hblD gene in that strains. The other reference strains of B. subtilisATCC 6633 and B. pumilus £OCK 0814 did not have that gene. Presence of hblD gene in the referencestrain of B. thuringiensis NCAIM 01262 shows that this organism can be potentially harmful for humanbeings what is in disagreement with the common opinion of microbiologists.

Polymorphism of nheB genes found in B. anthracis (strains Ames and Sterne), B. cereus (strains ATCC10987, ATCC 14579, ZK) and B. thuringiensis serovar konkukian str. 94�27 analysed in silico showed thatprimers designed by Hansen and Hendriksen (2001) are not 100% identical to the corresponding regions ofthat genes. Similarity of forward primer varied from 94.7 to 100% and reverse primer from 88.2 to 100%.This observation lead us to the conclusion that such primers can not be used for reliable PCR-based detec-tion of nheB gene in the wide number of bacterial species. Therefore, an attempt has been made to designour own set of universal primers with 100% similarity to the corresponding regions of nheB genes of allalready sequenced Bacillus strains. Figure 3 shows alignment of 273 bp long fragment of nheB DNAsequence from genomes of Bacillus strains belonging to the B. cereus group. PCR reaction made with thisprimers for 9 B. cereus isolates and 4 reference strains from culture collection revealed presence of charac-teristic 273 bp long amplicons for all isolates of Bacillus sp. 1�9, B. cereus £OCK 0807 and B. thuringiensisNCAIM 01262. Strains of B. pumilus £OCK 0814 and B. subtilis ATCC 6633 were deprived of nheB gene(Fig. 4). Obtained results confirmed observations from in silico analysis of B. cereus group genomes thatnheABC operon is characteristic for that group of organisms. This finding also confirmed previous state-ment that B. thuringiensis can be harmful for human being and its use for the production of biologicalpesticides may create biological hazard.

Literature

B e e c h e r D.J. and A.C.L. W o n g. 1994. Identification and analysis of the antigens detected by two commercial Bacillus cereusdiarrheal enterotoxin immunoassay kits. Appl. Environ. Microbiol. 60: 4614�4616.

B r e t t i n T.S., D. B r u c e, J.F. C h a l l a c o m b e, et al. 2004a. Complete genome sequence of Bacillus thuringiensis 97�27.ACCESSION NC_005957.

B r e t t i n T.S., D. B r u c e, J.F. C h a l l a c o m b e, et al. 2004b. Complete genome sequence of Bacillus cereus ZK. ACCESSIONCP000001.

Fig. 4. Electrophoregram of nheB gene fragment amplicons.W � DNA size marker; lanes 1� B. thuringiensis NCAIM 01262; 2 � B. cereus £OCK 0807; 3 � B. subtilis ATCC 6633;

4 � B. pumilus £OCK 0814; 5 � Bacillus sp. 1; 6 � Bacillus sp. 2; 7 � Bacillus sp. 3; 8 � Bacillus sp. 4;9 � Bacillus sp. 5; 10 � Bacillus sp. 6; 11 � Bacillus sp. 7; 12 � Bacillus sp. 8; 13 � Bacillus sp. 9.


B r e t t i n T.S., D. B r u c e, J.F. C h a l l a c o m b e, et al. 2004c. Complete genome sequence of Bacillus anthracis Sterne.ACCESSION NC_005945.

H a n s e n B.M. and N.B. H e n d r i k s e n. 2001. Detection of enterotoxic Bacillus cereus and Bacillus thuringiensis strains byPCR analysis. Appl. Environ. Microbiol. 67: 185�189.

I v a n o v a N., A. S o r o k i n, I. A n d e r s o n, et al. 2003. Genome sequence of Bacillus cereus and comparative analysis withBacillus anthracis. Nature 423: 87�91. ACCESSION NC_004722.

M a n t y n e n V. and K. L i n d s t r o m. 1998. A rapid PCR-based DNA test for enterotoxic Bacillus cereus. Appl. Environ.Microbiol. 64: 1634�1639.

M a r m u r J. 1961. A procedure for isolation of deoxyrybonucleic acid from microorganisms. J. Mol. Biol. 3: 208.N e i l J.R., G. C a l d o w, C.G. G e m m e l and I.S. H u n t e r. 2003. Production of diarrheal enterotoxins and other potential

virulence factors by veterinary isolates of Bacillus species associated with nongastrointestinal infections. Appl. Environ.Microbiol. 69: 2372�2376.

R a s k o D.A., J. R a v e l, O.A. O k s t a d, et al. 2004. The genome sequence of Bacillus cereus ATCC 10987 reveals metabolicadaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res. 32: 977�988. ACCESSIONNC_003909.

R e a d T., S. P e t e r s o n, N. T o u r a s s e, et al. 2003. The genome sequence of Bacillus anthracis Ames and comparison toclosely related bacteria. Nature 423: 81�86. ACCESSION NC_003997.


Optimization and Purification of Alkaline Proteases Producedby Marine Bacillus sp. MIG Newly Isolated from Eastern Harbour of Alexandria

MONA K. GOUDA*

Botany Department, Faculty of Science, Alexandria University, Alexandria, Egypt

Received 22 June 2005, revised 2 March 2006, accepted 10 March 2006

A b s t r a c t

A marine Bacillus strain was isolated from the eastern harbour of Alexandria and identified as Bacillus sp. MIG.Maximum activity of studied proteases was obtained when the bacterium was grown in medium with 1% wheat branand 0.5% yeast extract in addition to the mineral salts and incubated for 48 h at 30°C and 120 rpm. Two alkalineproteases (Pro 1 and Pro 2) were purified to homogeneity using cation exchange chromatography on CM-SepharoseCL-6B followed by Sephadex G-75 superfine. The optimum activities were at pH 11 or 12, and temperatures of 50 and55°C for Pro 1 and Pro 2 respectively. These two enzymes were relatively stable over pH range from 7.0�11. Pro 2 wasfound to be more stable at 50°C in absence of Ca2+ and retained about 47% of its activity after 3 h at this temperature,while Pro 1 lost its activity completely at the same conditions. The two enzymes were active against haemoglobin andcasein; in addition, Pro 2 exhibited moderate activity against keratin. Both enzymes were partially inhibited by Ag+ andHg2+. PMSF completely inhibited the enzymes, while dithiothreitol and 2-mercaptoethanol stimulated their activities,suggesting to be thiol-dependent serine proteases. The enzymes were stable in the presence of the surfactants andbleaching agent (H2O2) and relatively stable in presence of some commercial detergents.

K e y w o r d s: marine Bacillus sp. MIG; alkaline serine protease; thiol-dependent serine protease

Introduction

Alkaline proteases are a physiologically and commercially important group of enzymes used primarilyas detergent additives. This group of enzymes has other industrial applications such as in food, pharmaceu-tical, leather industry and recovery of sliver from used X-ray films (Anisworth, 1994; Inhs et al.,1999; Outtrup et al., 1995). In 1994, the total market for industrial enzymes accounted for approximately400 million $, of which enzymes worth 112 million $ used for detergent purposes (Hodgson, 1994). Alkalineprotease added to laundry detergents plays a specific catalytic role in the hydrolysis of protein stains suchas blood, milk, human sweat, etc. The increased usage of the protease as a detergent additive is mainly dueto its cleaning capabilities in environmentally acceptable, nonphosphate detergents (Mei and Jiang, 2005).

Although microbes from terrestrial sources are employed for industrial production of enzymes, the poten-tial for synthesis of several novel enzymes by marine microorganisms has been recognized (Chandrasekaran,1997). Diverse techniques have been used for the screening of novel enzymes with new biocatalytic capa-bilities and great potential for several industrial processes and other applications (Manachini and Fortina,1998). Large number of microorganisms produces proteases, but Bacillus strains are recognized as importantsources of commercial alkaline proteases because of their ability to secrete large amounts of enzymes withhigh activity (Beg and Gupta, 2003; Joo et al. 2004).

Joo and Chang (2005) reported that around 30�40% of the production cost of the industrial enzymesaccounted for the cost of the growth medium. Research efforts have been directed mainly towards evalua-ting the effect of various carbon and nitrogen nutrient cost-effective substrates on the yield of enzymes,requirement of divalent metal ions in the fermentation medium and optimization of environmental andfermentation parameters such as pH, temperature, aeration and agitation. In addition, no defined medium

* Correspondence to: Mona Gouda. Tel.: 0020127430861; fax: 002033911794, e-mail address: [email protected]

120 Gouda M.K. 2

has been established for the optimum production of alkaline proteases from different microbial sources.Each organism has its own special conditions for maximum enzyme production (Kaur et al., 2001; Kumarand Takagi, 1999; Razak et al., 1994). In order to reduce medium costs, different low-cost substrateswere screened and in course of this wheat bran, molasses, soybean meal and feather were used for cost-effective production of multiple forms of alkaline proteases by marine Bacillus sp. MIG. The presentwork also describes purification of two alkaline proteases from this strain to homogeneity. Some propertiesof the pure enzymes were also tested.

Experimental


Microorganisms. Thirty-five marine bacteria were isolated from the eastern harbour of Alexandria (Egypt). All isolates werecultured on skim milk agar plates. The isolates, which show clear zones on the plates, were cultivated in liquid production mediumto test their ability to produce alkaline proteases.

Enzyme production. The production of alkaline protease from Bacillus sp. MIG was carried out in marine medium which havethe following composition, (g l�1): peptone, 3; yeast extract, 1; casein, 10; ferric citrate, 0.1; NaCl, 19.45; MgCl2, 8.8; Na2SO3,3.24; CaCl2, 1.8, the pH of the medium was adjusted to 7.5. The medium was inoculated with 1% of 24 h seed culture and incubatedunder shaked condition (120 rpm) and 30°C for different periods. Different carbon and nitrogen sources were used in the presentwork for optimization of nutritional factors. The physical parameters including (pH of the medium and temperature of incubation)were also tested. At the end of the incubation period, the cell-free enzyme supernatant was obtained by centrifugation at 10,000 gfor 15 min at 6°C.

Enzyme purification. The cold cell-free supernatant obtained from the optimized medium after 48-h incubation was precipi-tated with two volumes of cold acetone and then collected by centrifugation. The precipitate was resuspended in a minimal volumeof Tris-HCl buffer (0.02 M, pH 7.5) containing 5 mM CaCl2. After removing the insoluble materials by centrifugation for 15 min at6°C and 10,000 g, the clear supernatant was applied to CM-Sepharose CL-6B ion exchange column (Pharmacia) per-equilibratedwith the same buffer. The column was washed with the same buffer and eluted with stepwise gradient (0�0.5 M) of NaCl in thesame buffer. Fractions of 5 ml were collected at a flow rate of 1 ml/min, and then the protein content and enzyme activity of eachfraction were determined. The active fractions were collected and dialyzed against the same buffer without NaCl. The fractions,which are required further purification, were applied to Sephadex G-75 superfine gel filtration column. The column was equili-brated with the last mentioned buffer and eluted with the same buffer. Fractions of 2 ml were collected at a flow rate of 0.5 ml/min,and the protein content and enzyme activity were assayed. All active fractions were stored at �20°C for further study.

Enzyme assay. Protease activity was determined using casein as substrate. Casein was dissolved at 1% in glycine-NaOH buffer(0.1 M, pH 10). The assay mixture consisted of 650 µl buffer, 250 µl substrate and 100 µl of diluted enzyme and incubated at 37°Cfor 10 min. The reaction was terminated by the addition of 500 µl of trichloroacetic acid reagent (TCA), and then centrifuged ineppendorf centrifuge for 10 min to remove the undigested protein. Protease activity was determined as released tyrosine in thesupernatant (Lowry et al., 1951). One unit of the enzyme was defined as the amount of the enzyme resulting in the release of 1 µgof tyrosine ml�1 min�1 under the assay conditions. The protein content was also determined by Lowry et al. (1951) using bovineserum albumin as a standard.

SDS-Polyacrylamide gel electrophoresis and detection of enzymatic activities in the gel. The purity and relative molecularweights of the purified enzymes were estimated by SDS-PAGE using a 12% polyacrylamide gel according to the method of Laemmli(1970). The enzyme activities were tested in the gel following the method described by Heussen and Dowdle (1980).

Substrate specificity. Protease activities of purified enzymes against various protein substrates including BSA, gelatin,azocasein, azoalbumin, haemoglobin and keratin were assayed using 1% from each substrate dissolved in glycine-NaOH buffer,pH 11. The reaction was terminated with TCA and released products were measured at the suitable wavelength for each substrate.The activity toward casein was taken as control.

Effect of metal ions, inhibitors, surfactants and detergents. The effect of different metal ions, protease inhibitors, surfac-tants and commercial detergents on the activity of purified proteases was determined by incubating them with the enzymes for30 min at 40°C and the residual activities were measured by the standard assay procedure.


Selection of the best alkaline protease-producing organism. From the tested isolates, four have theability to produce alkaline proteases. The best alkaline protease producer was identified using 16S rRNAmethodology. Part of 16S rRNA gene was amplified, sequenced and deposited in the GeneBank databasewith accession number DQ076248 as Bacillus sp. MIG. Comparing the obtained sequence with the se-quences available in the NCBI revealed 97% similarity with Bacillus pumilus strain: M1-9-1. This organismwas selected for production and purification of alkaline proteases.

Correlation between growth and protease production. The protease production by the test organismstarted in the exponential growth phase and enzyme activity showed linearity with growth. The maximumactivity (1070.86 Uml�1) was obtained in the stationary phase after 48 h and remains more or less stable

121Alkaline proteases in marine Bacillus sp.2

until 72 h, and then decreased with increasing the incubation time (data not shown). A similar trend wasreported for extracellular protease production by Bacillus sp. (Oberoi et al., 2001), Bacillus subtilis PE-11(Adinarayana et al., 2003) and by Bacillus clausii (Kumar et al., 2004). The cell density increased with timeand reached its maximum after 24 h.

Effect of temperature and pH on the enzyme production. The effect of incubation temperature andpH of the production medium are critical factors and need to be optimized. The optimum temperature forenzyme production was found to be 30°C, increasing the temperature led to decrease the enzyme production(Fig. 1). Higher temperatures at 40 and 45°C caused more than 37 and 77% loss in the enzyme compared to30°C. The protein content increased with the increase in enzyme activity except at 45°C, while the enzymeactivity decreased, the protein content was increased. Ray et al. (1992) reported that temperature couldregulate the synthesis and secretion of extracellular proteases by microorganisms. The effect of the initialpH of the culture medium on the enzyme production was studied in pH range of 4�10, the initial pH wasadjusted with NaOH or HCl. No growth was found at pH 4. The enzyme was produced over pH range from6�10 with a maximum value at pH 7, in which no pH adjustment was made. In order to prove that theenzyme was produced in neutral to weak alkaline pH, the initial pH was adjusted using sodium carbonate. Inthis experiment, maximum enzyme activity was obtained in pH range from 7�8. Drastic decrease in bacterialgrowth and enzyme production was observed, when the initial pH was in the alkaline range (data not shown).These results indicate that the Bacillus sp MIG is a neutralophilic organism and produces alkaline proteases.

Effect of carbon sources on enzyme production. The effect of carbon sources was investigated inmedium containing (3 g l�1 peptone and 1 g l�1 yeast extract). The tested carbon sources were supplementedto the medium at 1%. The results presented in Figure 2 showed that the addition of wheat bran, molasses,

Fig. 2. Effect of supplementation of differentC-sources to the control on the proteolyticactivity of Bacillus sp. MIG, the C-sourceswere added at 1%; control: basal mediumwithout casein.

0

200

400

600

800

1000

1200

1400

1600

Glu

cose

Fru

ctos

e

Mal

tose

Sta

rch

Mol

asse

s

Whe

atbr

an

Suc

rose

Con

trol

C-So rces

0

1

2

3

4

5

6

7 U ml-1 mg ml-1

Cas

eina

se a

ctiv

ity (U

ml�1

)

Pro

tein

(mg

ml�1

)

C-sources

U ml�1 mg ml�1

Fig. 1. Effect of incubation temperature onthe production of proteolytic enzymes byBacillus sp. MIG

Cas

eina

se a

ctiv

ity (U

ml�1

)

Pro

tein

(mg

ml�1

)

Temperature °C

0

200

400

600

800

1 000

1 200

1 400

20 25 30 35 40 4 5 50

0

1

2

3

4

5

6

7U m l -1 m g m l-1U ml-1 mg ml-1

122 Gouda M.K. 2

starch or maltose enhanced the enzyme production with the maximum value in the presence of wheat bran(1449.15 U ml�1). The use of wheat bran in the production medium is very important, because it is one ofthe cheap and readily available carbon sources. The estimated cost of wheat bran was found to be 0.002 $for one liter production medium. More recently, alkaline protease production from Bacillus sp. was investi-gated in solid-state fermentation using wheat bran and lentil husk, where wheat bran was found to bea better source (Uyar and Baysal, 2004). Studies on alkaline proteases reported that the addition of starchto the culture medium induced enzymes synthesis (Chauhan and Gupta, 2004; Fang et al., 2001). On theother hand, addition of other carbon sources like sucrose, glucose or fructose reduced the activity by about60, 42 and 40% (respectively) compared to the control. Removal of casein from the medium with peptoneand yeast extract had no effect on the enzyme production, indicating the constitutive nature of Bacillus sp.MIG enzyme. Production of microbial proteases has been found to vary from being constitutive to partiallyinducible in nature (Gupta et al., 2002; Puri et al., 2002). Increasing the concentration of wheat bran up to2.5% had no affect on enzyme activity.

Effect of nitrogenous compounds. Effect of different nitrogen containing compounds was evaluatedin medium with wheat bran as the sole carbon source (Fig. 3). The nitrogen source in the basal medium(3 g l�1 peptone and 1 g l�1 yeast extract) was replaced on their nitrogen equivalent by different organic andinorganic nitrogen sources. It was found that yeast extract was the best organic nitrogen source and gave thehighest activity (1601.34 U ml�1), while sodium and potassium nitrate were the best inorganic nitrogensource. Ammonium nitrate and chloride totally repressed the enzyme production and ammonium sulphategave only 8.6% compared to the control medium. Johnvesly and Naik, (2001) reported that protease pro-duction by Bacillus sp. JB-99 was supported by nitrate nitrogen viz. sodium and potassium nitrate, whileammonium nitrogen completely inhibited the production. Soybean meal, casein hydrolysate and casein alsosupported high enzyme activity. Peptone and urea reduced the activity by about 20 and 47% (respectively)compared to the control. The addition of 1% feather to the medium with 1% wheat bran supported theenzyme production and gave high activity, but the incubation time was 4-days. Bacillus sp. P-001A wasfound to degrade feather after at least 5-days (Atalo and Gashe, 1993). It was also found that the use ofmedium with 1% feather as the sole carbon and nitrogen source gave about 60% of the activity obtainedin presence of wheat bran and feather and the addition of 1% glucose to the feather reduced the activity byabout 30% (data not shown). On the other hand, the protein content in the culture filtrate was not greatlyaffected by the nitrogen sources.

Enzyme purification. The purification scheme of the extracellular proteases produced by Bacillus sp.MIG is summarized in Table I. Two proteases were purified to homogeneity using cation exchange chroma-tography on CM-Sepharose CL-6B, followed by gel filtration on Sephadex G-75 superfine. The steps werevery effective and combined to give overall purification of 19.3 and 16.1-fold for the protease 1(Pro 1) andprotease 2 (Pro 2) respectively. Figure 4 shows that two fractions were obtained after the cation exchange.The first one was eluted using 0.1 M NaCl and contained three main protein bands, in addition to minorproteins and the second was eluted with 0.5 M NaCl and contained one major band and some minor bands.

0

200

400

600

800

1000

1200

1400

1600

1800

0

1

2

3

4

5

6

7

8 U ml-1 mg ml-1

Cas

eina

se a

ctiv

ity (U

ml�1

)

Pro

tein

(mg

ml�1

)

Nitrogen sources

Fig. 3. Effect of differentN2-sources on the productionof proteolytic activity by Ba-cillus sp.MIG, the N2-sourceswere added on the basis ofnitrogen equivalent to 3 g l�1

peptone and 1 g l�1 yeast ex-tract. * 4-days incubation.

Am

m.

nitr

ate

Am

m.

chlo

ride

Am

m.

sulp

hate

Sod

ium

nitr

ate

Pot

. nitr

ate

Ure

a

Soy

abea

nm

eal

Pep

tone

Yea

syex

trac

t

Cas

ein

Cas

ein

hydr

olys

ate

Feat

her*

Con

trol

(U ml�1) (mg ml�1)


The rechromatography of the first fraction from the cation exchange on Sephadex G-75 gave two purebands. The specific activities for both proteases are 5023.1 and 4185.5 Umg�1 respectively. The purifiedenzymes were also confirmed to be homogeneous by SDS-PAGE with molecular weights of about 36 and23 kDa respectively (Fig. 4). The molecular masses of microbial alkaline proteases ranged between 15 and36 kDa, with few exceptions of high molecular mass, such as 42 kDa from Bacillus sp. PS719 (Towatanaet al., 1999) and very high (90 kDa) from Bacillus subtilis (Kato et al., 1992). Zymogram activity stainingrevealed three major clear zones of proteolytic activities that are active over broad range of pH and fourthone that only active in the alkaline range (Fig. 5).

Effect of pH on activity and stability of both enzymes. The effect of pH on the activity of both puri-fied proteases was determined at 40°C in the pH range from 6.0�12.0. The two proteases were more activein the alkaline range with maximum activity at pH 11 and 12 for Pro 1 and Pro 2 respectively (Fig. 6a). Thetwo enzymes were relatively stable over a pH range from 7�10 for 20 h at 30°C and retained about 88 and92% at pH 10 after the same time (Fig. 6b). Two alkaline proteases AP-1 and AP-2 from alkalophilicBacillus spp. were also optimally active at pH 11 and 12, respectively, and were stable for 4 h in pH rangeof 6�12 for AP-1 and 6�9 for AP-2 (Kumar et al., 1999). The optimum pH obtained for enzymes reportedin this study, are higher than the values pH 9 (Rahman et al., 1994) and pH 10.5 (Beg and Gupta, 2003) forother alkaline proteases.

Effect of temperature on activity and stability of both enzymes. The optimum temperatures for Pro 1and Pro 2 were found to be 50 and 55°C respectively (Fig. 7a). It was also found that Pro 2 was relatively

Crude extract 400250 1542 259.6 100 1.0

Acetone precipitation 300650 589 510.4 75.1 1.9

CM-Sepharose CL-6BEluted with 0.1M NaCl 121300 90 1347.78 30.3 5.2Eluted with 0.5M NaCl 30213 15 2014.2 7.5 7.8

Sephadex G-75 superfinePro 1 50231 10 5023.1 12.5 19.3Pro 2 54412 13 4185.5 13.6 16.1

Table ISummary of purification steps

StepsTotal activity

(U)Total protein

(mg)Specific activity

(Umg�1)Yield(%)

Foldpurification

Fig. 4. SDS-PAGE of purified proteases produced by Bacillus sp.MIG. Lane 1 and 2: molecular mass marker proteins; lane 3: crudeextract; lane 4: acetone fraction; lane 5: CM-Sepharose fractions(0.1M NaCl); lane 6: CM-Sepharose fractions (0.5M NaCl); lane 7(pro 1) and 8 (pro 2) obtained after gel filtration using G-75 superfine.

Fig. 5. Activity pattern of Bacillus sp. MIG proteasesin SDS-PAGE containing 0.05% casein. After electro-phoresis the gels were washed in Triton X-100 toremove the SDS, then incubated at different pH�s.Lane 1: crude extract (pH 11); lane 2, 3, 4 and5: acetone fraction (pH 11, 9, 7.5 and 6 respectively).

1 2 3 4 5 6 7 8

MW(kDa)

67

45

29

▼▼

▼

▲

▲

▲

▲▲

▲▲

1 2 3 4 5

124 Gouda M.K. 2

active at high temperatures than Pro 1. The thermal stability of the two enzymes was examined by preincu-bation of the enzymes at pH 11 for 3 h at temperatures 40 and 50°C in presence and absence of 5 mM CaCl2,then the residual activities were determined under the standard assay conditions. Both enzymes are stable inpresence of CaCl2 at 40°C and relatively stable in its absence at the same temperature (Fig. 7b). At 50°C,in the absence of calcium chloride, Pro 1 lost about 46 and 100% of its activity after 90 and 180 min, whilePro 2 lost only 24 and 53% after the same time. On the other hand, the two enzymes retained more than 80%after 2 h at 50°C in presence of 5 mM CaCl2. These results revealed that calcium chloride increased thethermal stability of both enzymes. Similar optimum temperatures were reported for AP-1 and AP-2 fromBacillus spp. (Kumar et al., 1999). Alkaline protease from B. mojavensis was optimally active at tempera-ture of 60°C, with rapid loss of activity above 65°C (Beg and Gupta, 2003), while lower optimum tempera-ture (45°C) was reported for other protease (Rattary et al., 1994). Alkaline proteases from Nocardiopsis sp.retained only 60% after 2 h at 50°C (Moreira et al., 2003). Generally, most of the commercial availableSubtilisin-type proteases are active in the pH and temperature range between 9.0�12.0 and 50�60°C, respec-tively (Beg and Gupta, 2003).

0

20

40

60

80

100

120

7 8 9 10 11 12

p H

Re

lati

ve

ac

tiv

ity

(%

)

Pro 1

Pro 2

(b)

0

20

40

60

80

1 00

5 6 7 8 9 10 11 1 2 13pH

Re

lati

ve a

ctiv

ity

(%)

Pro1

Pro2

(a)

Fig. 6. Effect of pH on the activity (a) and stability (b) of Pro 1 and Pro 2 produced by Bacillus sp MIG. Activity was assayed at40°C. Buffers used were phosphate, pH 6.0�7.5; Tris-HCl, 8.0�9.0 and glycine-NaOH, 9.5�12, each at 100 mM. In case of stability,

the enzymes were preincubated in different pH values for 20 h at 30°C.

2 0

4 0

6 0

8 0

1 0 0

1 2 0

2 0 3 0 4 0 5 0 6 0 7 0

Pr o 1

Pr o 2

0

20

40

60

80

100

120

0 50 1 00 150 200

w ithout Ca 40°C

w ith Ca 40°C

w ithout Ca 50°C

w ith Ca 5 0°C

w ithout Ca 40°C

w ith Ca 40°C

w ithout Ca 50°C

w ith Ca 50°C

Rel

ativ

e ac

tivity

(%)

Time (min)

Fig. 7. Effect of temperature on the activity (a) and stability (b)of Pro 1 and Pro 2 produced by Bacillus sp MIG. The optimumtemperature was determined at the range between 25 and 65°C. Thestability was determined by incubating the enzymes at temperatures40 and 50°C for different time, solid lines for Pro 1 and dashed

lines for Pro 2.

(a) (b)

Rel

ativ

e ac

tivity

(%)

Temperature (°C)


Substrate specificity. The ability of the Pro 1 and Pro 2 to hydrolyze different proteins was tested. Itwas found that Pro 1 exhibited the highest activity towards casein and bovine serum albumin and goodactivity with haemoglobin, while low level of activity was detected with modified substrates ( azocasein andazoalbumin). On the other hand, Pro 2 showed the highest activity toward casein but no activity with bovineserum albumin and azoalbumin. Pro 2 also showed a moderate activity against keratin, while Pro 1 had noactivity on the same substrate. Both enzymes hardly hydrolyze gelatin. Many of the previous studies alsorevealed that alkaline proteases showed highest activity towards casein relative to other proteins includingBSA, haemoglobin, keratin and azocasein (Freeman et al., 1993; Rahman et al., 1994). The two alkalineproteases isolated from some Bacillus spp. exhibited very low keratinolytic activity (Kumar et al., 1999).The ability of the Pro 1 and Pro 2 produced by the test organism to hydrolyze a wide range of proteinssubstrate may be advantageous for its use in detergents against a wide variety of stains.

Effect of metal ions. The effect of different metal ions on the activity of both purified enzymes was alsotested. Of all the tested ions Hg2+ and Ag+ inhibited the activity of both enzymes by about 50�70%. Manyalkaline proteases were reported to be inhibited by mercury and sliver (Banerjee et al., 1999; Beg andGupta, 2003; Kumar et al., 1999). However, metal ions such as Mn2+, Mg2+, Co2+ and Ca2+ increasedor stabilized the activity of the two enzymes, confirming that these cations take part in the stabilization ofthe protease structure and are required for protection against thermal denaturation (Paliwal et al., 1994).Another important feature of the enzymes used in leather industry was the salt tolerant capacities. In thepresence of 1 M NaCl, the two enzymes retained 100% of their activities after 60 min preincubation at 40°C(data not shown). It was reported that alkaline protease produced from haloalkaliphilic Bacillus sp. lostabout 20% when perincubated with 0.17 M NaCl for 30 min at 37°C (Gupta et al., 2005), while Bacillus sp.JB-99 protease lost only 16% in the presence of 1 M NaCl after 2 h at 45°C (Johnvesly et al., 2002).

Effect of inhibitors, surfactants and detergents. The results obtained in this study revealed that bothenzymes were completely inhibited by 2 mM PMSF, a serine protease inhibitor, while 2-mercaptoethanoland dithiothereitol stimulate the activity suggesting that both are thiol-dependent serine proteases. Similarresults were observed for B. mojavensis protease (Beg and Gupta, 2003). The two proteases were found tobe very stable against non-ionic surfactants (such as Tween 80 and Triton X-100) and stable in the presenceof anionic surfactants, SDS. Matta and Punj (1998) reported that protease from B. polymyxa B-17 lostapproximately 10% of its activity on treatment with 1 mM SDS. The enzymes also exhibited strong stabilityagainst bleaching agent, hydrogen peroxide and relatively stable in presence of commercial detergents.Singh et al. (2001) reported that SSR1 protease retained 40�90% of its activity in the presence of localdetergents. The stability of both enzymes in the presence of EDTA suggesting that metal cofactors are notrequired for enzyme activity. This property of the enzyme was very useful for application as detergentadditive since chelating agents, which function as water softeners and are involved in the removal of stainsare components of the detergent and then specifically bind divalent cations (Beg and Gupta, 2003).

From these results, it is envisage that Bacillus sp. MIG can be a potential source of alkaline proteasesfor use in different industrial application, because it produced the enzymes at a prominent level using cost-effective medium. The broad substrate specificity of the proteases from Bacillus sp. MIG may be also advanta-geous for its use in detergents against wide variety of stains and the stabilities in the presence of highsodium chloride concentration permit their application in leather industry as an unhairing agent, removingthe need to use toxic reagents.

Literature

A d i n a r a y a n a K., P. E l l a i a h and D.S. P r a s a d. 2003. Purification and partial characterization of thermostable serinealkaline protease from a newly isolated Bacillus subtilis PE-11. AAPS Pharm. Sci. Tech. 4: 1�9.

A n i s w o r t h S.J. 1994. Soap and detergents. Chem. Eng. News 72: 34�59.A t a l o K. and B.A. G a s h e. 1993. Protease production by a thermophilic Bacillus species (P-001A) which degrades various

kinds of fibrous proteins. Biotechnol. Lett. 15: 1151�1156.B a n e r j e e U.C., R.K. S a n i, W. A z m i and R. S o n i. 1999. Thermostable alkaline protease from Bacillus brevis and its

characterization as a laundary detergent additive. Process Biochem. 35: 213�219.B e g Q.K. and R. G u p t a. 2003. Purification and characterization of an oxidation-stable, thiol-dependent serine alkaline pro-

tease from Bacillus mojavensis. Enzyme Microbial. Technol. 32: 294�304.C h a n d r a s e k a r a n M. 1997. Industrial enzymes from marine microorganisms: the Indian scenario. J. Marine Biotechnol. 5: 86�89.C h a u h a n B. and R. G u p t a. 2004. Application of statistical experimental design for optimization of alkaline protease produc-

tion from Bacillus sp. RGR-14. Process Biochem. 39: 2115�2122.

126 Gouda M.K. 2

F a n g Y.Y., W.B. Ya n g, S.L. O n g, J.Y. H u and W.J. N g. 2001. Fermentation of starch for enhanced alkaline proteaseproduction by constructing an alkalophilic Bacillus pumilus strain. Appl. Microbiol. Biotechnol. 57: 153�160.

F r e e m a n S.A., K. P e e k, M. P r e s c o t t and R. D a n i e l. 1993. Characterization of a chelator-resistant proteinase fromThermus strain Rt4A2. Biochem. J. 295: 463�469.

G u p t a A., I. R o y, R.K. P a t e l, S.P. S i n g h, S.K. K h a r e and M.N. G u p t a. 2005. One-step purification and characte-rization of an alkaline protease from haloalkaliphilic Bacillus sp. J. Chromatogr. A. 1075: 103�108.

G u p t a R., Q.K. B e g, S. K h a n and B. C h a u h a n. 2002. An overview on fermentation downstream processing and proper-ties of microbial alkaline proteases. Appl. Microbiol. Biotechnol. 60: 381�395.

H e u s s e n C. and E.B. D o w d l e. 1980. Electrophoretic analysis of plasminogen activators in polyacrylamide gels containingsodium dodecyl sulfate and copolymerized substrates. Anal. Biochem. 102: 196�202.

H o d g s o n J. 1994. The changing bulk biocatalyst market. Biotechnology 12: 289�290.I n h s D.A., W. S c h m i d t and F.R. R i c h t e r. 1999. Proteolytic enzyme cleaner, US Patent Number 5961366.J o h n v e s l y B. and G.R. N a i k. 2001. Studies on production of thermostable alkaline protease from thermophilic and alkalo-

philic Bacillus sp. JB-99 in a chemically defined medium. Process Biochem. 37: 139�44.J o h n v e s l y B., B.R. M a n j u n a t h and G.R. N a i k. 2002. Pigeon pea waste as a novel, inexpensive, substrate for production

of a thermostable alkaline protease from thermoalkalophilic Bacillus sp. JB-99. Bioresource Technol. 82: 61�64.J o o H.S., C.G. K u m a r, G.C. P a r k, S.R. P a l i k and C.S. C h a n g. 2004. Bleach-resistant alkaline protease produced by

a Bacillus sp. isolated from the Korean polychaeta, Periserrula leucophryna. Process Biochem. 3P: 1441�1447.J o o H.S. and C.S. C h a n g. 2005. Production of protease from a new alkalophilic Bacillus sp. I-312 grown on soybean meal:

optimization and some properties. Process Biochem. 40: 1263�1270.K a t o T., Y. Ya m a g a t a, T. A r a i and E. I c h i s h i m a. 1992. Purification of a new extracellular 90-kDa serine proteinase

with isoelectric point of 3.9 from Bacillus subtilis (natto) and elucidation of its distinct mode of action. Biosci. Biotech.Biochem. 56: 1166�1168.

K a u r S., R.M. Vo h r a, M. K a p o o r, O.K. B e g and G.S. H o o n d a l. 2001. Enhanced production and characterization ofa highly thermostable alkaline protease from Bacillus sp. P-2. World J. Microbiol. Biotechnol. 17: 125�129.

K u m a r C.G. and H. T a k a g i. 1999. Microbial alkaline proteases: from a bio-industrial viewpoint. Biotechnol. Advance 17:561�594.

K u m a r C.G., H.S. J o o, Y.M. K o o, S.R. P a i k and C.S. C h a n g. 2004. Thermostable alkaline protease from a novelmarine haloalkalophilic Bacillus clausii isolate. World J. Microbiol. Biotechnol. 20: 351�357.

K u m a r C.G., M.P. T i w a r i and K.D. J a n y. 1999. Novel alkaline serine proteases from alkalophilic Bacillus spp.: purifica-tion and some properties. Process Biochem. 34: 441�449.

L a e m m l i U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680�685.L o w r y O.H., N.J. R o s e b r o u g h, A.L. F a r r and R.J. R a n d a l l. 1951. Protein measurement with the Folin phenol

reagent. J. Biol. Chem. 193: 265�275.M a n a c h i n i P.L. and M.G. F o r t i n a. 1998. Production in sea-water of thermostable alkaline proteases by a halotolerant

strain of Bacillus licheniformis. Biotechnol. Letters 20: 565�568.M a t t a H. and V. P u n j. 1998. Isolation and partial characterization of a thermostable extracellular protease from Bacillus

polymyxa B-17. Int. J. Food Microbiol. 42:139�145.M e i C., X. J i a n g. 2005. A novel surfactants and oxidation-stable alkaline protease from Vibrio metschnikovii DL 33�51. Pro-

cess Biochem. 40: 2167�2172.M o r e i r a K.A., T.S. P o r t o, M.F.S. T e i x e i r a, A.L.F. P o r t o and J.L.L. F i l h o. 2003. New alkaline protease from

Nocardiopsis sp.: partial purification and characterization. Process Biochem. 39: 67�72.O b e r o i R., Q.K. B e g, S. P u r i, R.K. S a x e n a and R. G u p t a. 2001. Characterization and wash performance analysis of

an SDS-stable alkaline protease from a Bacillus sp. World J. Microbiol. Biotechnol. 17: 493�497.O u t t r u p H., C. D a m b m a n n, M. C h r i s t i a n s e n and D.A. A a s l y i n g. 1995. Bacillus sp. JP 395, method of making

and detergent composition. US Patent Number 5466594.P a l i w a l N., S.P. S i n g h and S.K. G a r g. 1994. Cation-induced thermal stability of an alkaline protease from a Bacillus sp.

Bioresource Technol. 50: 209�211.P u r i S., Q.K. B e g and R.G. G u p t a. 2002. Optimization of alkaline protease production from Bacillus sp. using response

surface methodology. Curr. Microbiol. 44: 286�290.R a h m a n R.N.Z.A., C.N. R a z a k, K. A m p o n, M. B a s r i, W.M.Z.W. Yu n u s and A.B. S a l l e h. 1994. Purification and

characterization of a heat stable alkaline protease from Bacillus stearothermophilus F1. Appl. Microbiol. Biotechnol. 40:822�827.

R a t t a r y F.P., W. B o c k e l m a n n and P.F. F o x. 1994. Purification and characterization of an extracellular proteinase fromBrevibacterium linens ATCC 9174. Appl. Environ. Microbiol. 61: 3454�3456.

R a y M.K., K.U. D e v i, G.S. K u m a r and S. S h i v a j i. 1992. Extracellular protease from the antarctic yeast Candidahumicola. Appl. Environ. Microbiol. 58: 1918�1923.

R a z a k N.A., M.Y.A. S a m a d, M. B a s r i, W.M.Z.W. Yu n u s, K. A m p o n and A.B. S a l l e h. 1994. Thermostable extra-cellular protease of Bacillus stearothermophilus: factors affecting its production. World J. Microbiol. Biotechnol. 10: 260�263.

S i n g h J., N. B a t r a and R.C. S o b t i. 2001. Serine alkaline protease from newly isolated Bacillus sp. SSR1. Process Biochem.36: 781�785.

T o w a t a n a N.H., A. P a i n u p o n g and P. S u n t i n a n a l e r. 1999. Purification and characterization of an extracellular pro-tease from alkaliphilic and thermophilic Bacillus sp. PS719. J. Biosci. Bioeng. 87: 581�587.

U y a r F. and Z. B a y s a l. 2004. Production and optimization of process parameters for alkaline protease production by a newlyisolated Bacillus sp. under solid state fermentation. Process Biochem. 39: 1893�1898.


Novel Yeast Cell Dehydrogenase Activity Assay in situ

JOANNA BER£OWSKA, DOROTA KRÊGIEL, LESZEK KLIMEK*, BARTOSZ ORZESZYNAand WOJCIECH AMBROZIAK

Institute of Fermentation Technology and Microbiology and* Institute of Materials Science and Engineering, Technical University of £ód�,

ul. Wólczañska 171/173, 90-924 £ód�

Received 14 October 2005, revised 2 January 2006, accepted 4 January 2006


A b s t r a c t

The aim of this research was to develop a suitable method of succinate dehydrogenase activity assay in situ for differentindustrial yeast strains. For this purpose different compounds: EDTA, Triton X-100, sodium deoxycholate, digitonin,nystatin and $-mercaptoethanol were used. The permeabilization process was controlled microscopically by primulinestaining. Enzyme assay was conducted in whole yeast cells with Na-succinate as substrate, phenazine methosulfate(PMS) as electron carrier and in the presence one of two different tetrazolium salts: tetrazolium blue chloride (BT) orcyanoditolyl tetrazolium chloride (CTC) reduced during the assay. In comparabile studies of yeast vitality the amountof intracellular ATP was determined according to luciferin/luciferase method. During the succinate dehydrogenaseassay in intact yeast cells without permeabilization, BT formazans were partially visualized in the cells, but CTCformazans appeared to be totally extracellular or associated with the plasma membrane. Under these conditions therewas no linear relationship between formazan color intensity signal and yeast cell density. From all chemical compoundstested, only digitonin was effective in membrane permeabilization without negative influence on cell morphology.Furthermore, with digitonin-treated cells a linear relationship between formazan color intensity signal and yeast cellnumber was noticed. Significant decreasing of succinate dehydrogenase activity and ATP content were observed duringaging of the tested yeast strains.

K e y w o r d s: yeasts cells permeabilization, succinate dehydrogenase, formazans

Introduction

Succinate dehydrogenase (SDH) plays a crucial role in the energy supply for physiological activity ofevery living cell, included microorganisms (Samokhvalov et al., 2004). Therefore SDH activity assay is animportant method for measurement of the yeast vitality in scope to control of different fermentation processes.

Reduction of various tetrazolium salts by dehydrogenases of metabolically active cells leads to pro-duction of highly colored end products � formazans. Tetrazolium salts commonly used in microbiologicalapplications include: 2-(p-iodophenyl)-3(p-nitrophenyl)-5-phenyltetrazolium chloride (INT) (Saliola et al.,2004), 2,3,5-triphenyl tetrazolium chloride (TTC) (Rosa and Tsou, 1963), and more recently, new gene-ration tetrazolium salts: 5-cyano-2,3-ditolyl tetrazolium chloride (CTC) (Berna� and Dobrucki, 1999),3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Berridge et al., 1996; Stowe et al.,1995; Freimoser et al., 1999), 2,3-bis(2-methoxy-4-nitro-5-sulphophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide (XTT) (Kuhn et al., 2003) or 4-[3-(4-idophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (WST1) (Berridge et al., 1996; Tsukatani at al., 2003).

Enzymatic reactions in yeasts are usually studied in cell-free extracts which requires disruption of cellsand as consequence, inactivation of particular enzymes often can be observed. In the case of enzymaticreaction conducted in situ the plasma membrane forms a barrier with low degree of penetration. Therefore, cellpermeabilization is recommended as an alternative method for the study of intracellular enzyme activities.

128 Ber³owska J. at al. 2

The aim of this research was to develop a suitable method of yeast cells permeabilization in succinatedehydrogenase activity assay in situ which can be used for different industrial Saccharomyces cerevisiae strains.

Experimental


Yeast strains used in this study. Five yeast strains Saccharomyces cerevisiae (races: Bc16a, Jaa, IIa, Ja 64 and baker�s indus-trial strain) used in this study orginated from the International Collection LOCK 105 of the Institute of Fermentation Technologyand Microbiology, Technical University of £ód�.

Media and cultivation. Yeast strains were cultivated in 50 ml of worth broth (Merck) at 30oC for 20 hours or 7 days withshaking at 220 rpm/min.

Yeast cells permeabilization. Different compounds: 1% Triton X-100 (Sigma-Aldrich), 0.1% sodium deoxycholate (Sigma-Aldrich), 0.05% digitonin (Fluka), 185 mg/100 ml EDTA (Sigma-Aldrich), 0.39 g/10 ml $-merkaptoetanol (POCh) were used totreated tested yeast strains before the assay. The permeabilization process was controlled microscopically by staining with 0.01%primuline (Sigma-Aldrich) (Duffus et al., 1984).

Formazans formation. Two different tetrazolium salts blue chloride BT (Sigma-Aldrich) or cyanoditolyl tetrazolium chlorideCTC (Polysciences) were used in the enzyme assay at concentration 0.68 mM and 4 mM respectively and were reduced duringassay to form crystals of formazan, which were observed microscopically. BT formazans in the bright-field microscopy were anopaque blue intracellular deposits and the CTC formazans formed red, highly fluorescent crystals with fluorescence emissionprimarily in the red region, when excitation wavelength was in the region 360� 370 nm.

Succinate dehydrogense SDH assay. This enzyme activity was assayed in whole cells. The cells were collected, washed andresuspended in Ringer solution. Standardized cell suspensions with 9×107 to 5×108 cell/ml were transferred to the tubes andcentrifuged (10 min, 2100×g). Supernatants were discarded and 0.3 ml 0.05 M Na-succinate solution (Merck), one small crystal ofPMS (Sigma-Aldrich) and 3 ml of solution contained 50 mg BT, 185 mg EDTA, 300 mg sodium azide (Sigma-Aldrich) in 100 mlwere added to the biomass. The mixture was incubated for 60 min at 37°C and then the reaction was stopped with 0.4 ml of 37%formaldehyde (POCh) and the samples were centrifuged as before (10 min, 2100×g). Supernatants were discarded and the pelletswere resuspended in DMSO (Sigma-Aldrich) for extraction of formazan crystals formed in yeast cells during the assay. Extractionwas conducted with three sequenced volumes of 3, 2 and 2 ml DMSO, then extracts were pulled and the final absorbance wasmeasured at 540 nm by spectrophotometer Specol 210 (Carl Zeiss, Jena, Germany). Each experiment was performed in triplicateand each data was the mean of three measurements. One SDH activity unit was equal to 1 µmol of formazan formed by 1×108 yeastcells at 37°C in 60 minutes.

ATP content. Intracellular ATP content was determined by luciferin/luciferase method using Hy-Lite2 luminometer (Merck) asrelative light units (RLU). (De Luca et al., 1979).

Results

In microscopic studies for SDH activity assay of yeast cells without permeabilitzation, BT formazans(BTf) can be seen partially in the cells, but CTC formazans (CTCf) appeared to be totally extracellularor associated with the plasma membrane (Fig. 1 Ia, b; Fig. 2 Ia, b). Under these reaction conditions nosimple linear correlation was observed between formazan absorbance and cell density (Fig. 3). Microscopicobservations after primuline staining showed that the yeast plasma membrane was the barrier for tetra-zolium salt in SDH activity assay in situ. In the case of cell permeabilization, when different active agentswere added, such treatment changed the morphology of cells. Only digitonin was effective in membranepermeabilization without negative influence on cell morphology (Fig. 4). After digitonin treatment visible

Fig. 1. BTf crystals.I) outside yeast cells; II) inside yeast cells; a) bright-field microscopy; b) electron microscopy

129Yeast dehydrogenase assay in situ2

Fig. 2. CTCf crystals.I) outside yeast cells; II) inside yeast cells; a) bright-field microscopy; b) electron microscopy

formazan crystals were observed inside the yeast cells but not outside them (Fig. 1 IIa,b; Fig. 2 IIa,b). Goodcorrelation (R2 = 0,97) between BTf absorbance intensity after DMSO extraction and number of cells wasseen. Linear correlation was observed in the concentration range of yeast cells from 9×107 to 5×108

per sample. For yeast cell concentrations below 1×107 per sample the formazan color intensity signals weretoo low to detect with good precision (Fig. 3).

The results obtained for SDH activity were in good agreement with ATP content in yeast cells. Signifi-cant decreasing of succinate dehydrogenase activity and ATP content were observed during aging of testedstrains (Table I).

number of cells/sample

8 8 8 8 8

y = 6 E -09x - 0 ,597 8

R2 = 0 ,971 4

p roce d ure w ith o u t d ig ito n in tr ea tm en t p ro cedu re w ith d ig ito n in tr ea tm en t

1.2

1.0

0.8

0.6

0.4

0.2

0.0

µM

for

maz

an

procedurewith out digitonin treatmentprocedure with digitonin treatment

y = 6E-09x � 0.5978R2 = 0.9714

1 × 108 2 × 108 3 × 108 4 × 108 5 × 108

Fig. 3. Yeast cells density and BTf signal

S. cerevisiae Bc16a 95.9787 0.028 0.0991 0.0019

S. cerevisiae Jaa 115.9787 0.0973 5.3479 0.0166

S. cerevisiae IIa 1.6037 0.0146 0.1241 0.0029

S. cerevisiae Ja64 201.7287 0.1069 0.9979 0.0071

S. cerevisiae industrial strain 86.1037 0.0631 0.1848 0.0025

Correlation factor R2 = 0.72 Correlation factor R2 = 0.97

Table ISDH activity and ATP content in different populations of Saccharomyces cerevisiae strains

Strain

20 h culture 7 day culture

ATP content[fM/cell]

SDH activity[µM/108 cells]

ATP content[fM/cell]

SDH activity[µM/108 cells]


Discussion

The earlier research described in the literature and conducted with different tetrazolium salt and yeastgenera showed that colorimetric signal of extracted formazans was not proportional to the cell number(Kuhn et al., 2003; Tsukatani at al., 2003). In our study the plasma membrane was the barrier to study SDHactivity in situ. This fact was confirmed by microscopic studies and primuline staining. This may explainthe lack of linear relationship between cell number and formazan absorbance in our previous experiments.Gentle permeabilization of yeast cell membrane, increasing its penetrability for tetrazolium salt, appeared tobe an important step for BT formazan signal and SDH assay in yeast cells (Caldwell, 1987). In earlierstudies on permeabilization, this process was conducted with digitonin at concentration from 0.01% to 0.1%during 10�30 min (Alamäe and Järviste, 1995; Freire et al., 1998; Samokhvalov at al., 2004). For digitonin-treated yeast cells linear relationship between cell number and BTf absorbance was observed.

The reaction with tetrazolium salt can be used in a wide range of biological assays including tests of cellviability. The developed method of SDH assay can be used in the study not only of yeast cell activity butto detect respiring cells in different ecosystems: water, food matrices, activated sludge or biofilms.

Acknowledgements. We gratefully acknowledge financial support of UE 6PR Grant NMP3-CT-2003- 504937 PERCERAMICS

Literature

A l a m ä e T. and A. J ä r v i s t e. 1995. Permeabilization of the methylotrophic yeast Pichia pinus for intracellular enzyme ana-lysis: a quantitative study. J. Microbiol. Methods 22: 193�205.

B e r n a � T. and J. D o b r u c k i. 1999. Reduction of a tetrazolium salt, CTC, by intact HepG2 human hepatoma cells: subcellularlocalisation of reducing systems. Biochim. Biophys. Acta 1451: 73�81.

B e r r i d g e M.V., A.S. T a n, K.D. M c C o y and R. W a n g. 1996. The biochemical and cellular basis of cell proliferationassays that use tetrazolium salts. Biochemica 4: 14�19.

C a l d w e l l R.B. 1987. Filipin and digitonin studies of cell membrane changes during junction breakdown in the dystrophic ratretinal pigment epithelium. Curr. Eye Res. 6: 515�526.

Fig. 4. Yeast cells after permeabilization and primuline staining.A) native cells; yeast cells after: B) digitonin, C) EDTA, D) Triton, E) deoxycholate, F) $-mercaptoethanol.

131Yeast dehydrogenase assay in situ2

D e L u c a M., J. W a n n l u n d and W.D. M c E l r o y. 1979. Factors affecting the kinetics of light emission from crude andpurified firefly luciferase. Anal. Biochem. 95: 194�198.

D u f f u s J.H., W. M c D o w e l l and D.J. M a n n e r s. 1984. The use of primuline to identify the septum polysaccharide of thefission yeast Schizosaccharomyces pombe. Stain Technol. 59: 79�82.

F r e i m o s e r F.M., C.A. J a k o b, M. A e b i and U. T u o r. 1999. The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra-zolium bromide] assay is a fast and reliable method for colorimetric determination of fungal cell densities. Appl. Environ.Microbiol. 65: 3727�3729.

F r e i r e A.P., A.M. M a r t i n s and C. C o r d e i r o. 1998. An experiment ilustrating metabolic regulation in situ using digitoninpermeabilized yeast cells. Bioch. Edu. 26: 161�163.

K u h n D.M., M. B a l k i s, J. C h a n d r a, P.K. M u k h e r j e e and M.A. G h a n n o u m. 2003. Uses and limitations of theXTT assay in studies of Candida growth and metabolism. J. Clin. Microbiol. 41: 506�508.

R o s a C.G. and K-Ch. T s o u. 1963. The use of tetranitro-blue tetrazolium for the cytochemical localization of succinic dehydro-genase. J. Cell Biol. 16: 445�454.

S a l i o l a M., P.C. B a r t o c c i o n i, I.T. D e M a r i a L o d i and C. F a l c o n e. 2004. The deletion of the succinate dehydro-genase gene KlSDH1 in Kluyveromyces lactis does not lead to respiratory deficiency. Euracyotic Cell 3: 589�597.

S a m o k h v a l o v V., V. I g n a t o v and M. K o n d r a s h o v a. 2004. Inhibition of Krebs cycle and activation of glyoxylatecycle in the course of chronological aging of Saccharomyces cerevisiae. Biochimie 86: 39�46.

S t o w e R.P., D.W. K o e n i g, S.K. M i s h r a and D.L. P i e r s o n. 1995. Nondestructive and continuous spectrophotometricmeasurement of cell respiration using a tetrazolium-formazan microemulsion. J. Microbiol. Methods 22: 283�292.

T s u k a t a n i T., T. O b a, H. U k e d a and K. M a t s u m o t o. 2003. Spectrophotometric assay of yeast vitality using 2,3,5,6,-tetramethyl-1,4-benzoquinone and tetrazolium salts. Anal. Sci. 19: 659�664.


In vitro Activity of Caspofungin against Planktonicand Sessile Candida sp. Cells

ANNA SEREFKO, BEATA CHUDZIK and ANNA MALM

Department of Pharmaceutical Microbiology, Medical University of Lublin,Chod�ki 1, 20-093 Lublin, Poland

Received 12 October 2005, revised 27 February 2006, accepted 1 March 2006


A b s t r a c t

Candida sp. may be regarded as one of the leading etiologic agents of hospital-acquired infections, including thoserelated with the indwelling medical devices, which become colonized by the yeasts, accompanied by biofilm formation.In this paper we assayed in vitro susceptibility to caspofungin of planktonic and sessile cells of nasopharyngeal isolatesof Candida sp. Two types of biomaterials were used � silicone elastomer-coated latex urinary Foley catheter and PCVThorax catheter. The minimal inhibitory concentrations (MIC) of caspofungin for planktonic Candida sp. cells rangedfrom 0.008 to 0.031 mg/l, while the minimal fungicidal concentrations (MFC) from 0.008 to 0.062 mg/l, with MFC/MICratios ≤2. The minimal concentration of caspofungin preventing adhesion process of Candida sp. on both biomaterialsranged from 0.004 to 0.031 mg/l, while preventing biofilm formation from 0.004 to 0.062 mg/l. In contrast, muchhigher minimal concentrations of caspofungin were needed to eradicate the mature biofilm (0.25 to >8 mg/l). In allcases, drug concentrations depended on the strain and the biomaterial used. Our preliminary data suggest thatcaspofungin, showing good anti-adherent activity in vitro against Candida sp., appears to be a potential agent ratherfor prophylaxis of the yeast infections associated with biomaterials but not for their treatment.

K e y w o r d s: caspofungin, Candida sp., biomaterials, adhesion, biofilm

Introduction

Recently, the yeasts belonging to the genus Candida may be regarded as one of the leading etiologicagents of hospital-acquired infections, including those related with the indwelling medical devices such ascatheters, prosthetic joints and heart valves, dentures etc. These devices become colonized by the yeasts,accompanied by biofilm formation (Hawser and Douglas, 1994; Douglas, 2002; Jabra-Rizk et al., 2004).Treatment of candidiasis often presents a challenge for clinicians, since the number of effective antifungalagents at their disposal is limited, due to increasing resistance of the pathogens. In addition, sessile cellsof Candida sp. within a biofilm are even more insensitive to current antimicrobial therapy in comparisonto their planktonic (free-floating) counterparts. Therefore, the pharmaceutical industry is still working onthe discovery of novel drugs which might reinforce conventional antifungal armamentarium (Chandra et al.,2001; Bachmann et al., 2002; Kuhn et al., 2002; Jabra-Rizk et al., 2004).

Caspofungin is the first antifungal compound of a new echinocandin class with a unique mode of action.It inhibits the synthesis of 1,3-$-D-glucan, a key component of the fungal cell wall, that is essential forosmotic stability, cell growth and cell division (Letscher-Bru et al., 2003). This antibiotic should be effec-tive in combating both planktonic and biofilm-associated Candida sp. populations. However, the literaturedata regarding the effect of caspofungin in vitro on Candida sp. biofilm formation and its eradication arecontroversial (Bachmann et al., 2002; Kuhn et al., 2002; Ramage et al., 2002; Soustre et al., 2004).

Here we presented data on the in vitro susceptibility to caspofungin of planktonic and sessile cells ofnasopharyngeal isolates of Candida sp.

134 Serefko A. et al. 2

Experimental


Microorganisms. A total of 7 clinical isolates of Candida sp. possessing hydrophilic or hydrophobic cell structure were stud-ied. The hydrophobicity of cell surface was assessed using salt aggregation test (Lindahl et al., 1981). The collection included thefollowing isolates: C. albicans (1 hydrophilic and 2 hydrophobic isolates), C. famata (1 hydrophilic and 1 hydrophobic isolates),C. glabrata (1 hydrophobic isolate), C. krusei (1 hydrophilic isolate). The isolates were obtained from nasopharynx of patients withlung cancer undergoing pulmonary resection and were stored on Sabouraud dextrose agar and before each experiment they weresubcultured on Sabouraud glucose broth.

Caspofungin. Standard antifungal powder of caspofungin (caspofungin acetate) was examined (Merck & Co., Inc., USA).Stock solution containing 16 mg/ml was prepared in distilled water and was stored frozen at �20°C.

Determination of minimal inhibitory concentration (MIC) and minimal fungicidal concentration (MFC) of caspofungin.Determination of MIC of caspofungin for planktonic Candida sp. cells was performed by a broth microdilution method in accor-dance with the guidelines recommended by CLSI (Clinical Laboratory Standards Institute), using serial two-fold dilutions ofcaspofungin in Sabouraud glucose broth. Final concentrations of caspofungin ranged from 0.0002 to 16 mg/l. Stock inoculumsuspensions of yeasts were prepared in Sabouraud medium and adjusted to optical density corresponding with 0.5 Mc Farlandstandard i.e. 150×106 CFU (colony forming units). After 48 h of incubation at 35°C, the MICs were assessed visually as the lowestdrug concentration showing complete growth inhibition. In order to determine the MFC of caspofungin for the planktonic cells ofthe yeasts, 10 µl from each tube that showed thorough growth inhibition, from the last positive one and from the growth control wasstreaked onto Sabouraud dextrose agar plates. After 48 h of incubation at 35°C, the MFCs were assessed visually as the lowest drugconcentration at which there was no growth. All experiments were done in triplicates. The representative data are presented.

Biomaterials. All assays were carried out on two types of catheters that differed in unevenness of surface from each other� silicone elastomer-coated latex urinary Foley catheter and PCV Thorax catheter.

The effect of caspofungin on adhesion of Candida sp. and biofilm formation on the biomaterials. The adhesion process andbiofilm formation were determined by using the MTT (tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide)reduction assay (Levitz et al., 1985). The catheters used were cut aseptically into ca 0.5 cm2 fragments and placed into Petri dishes.The standardized yeast suspensions (optical density of 0.5 Mc Farland standard) were prepared. Various concentrations ofcaspofungin (0.004�8 mg/l) were used. (i) In order to assay the effect of caspofungin on adhesion process, the yeast suspensions insterile PBS (phosphate-buffered saline) containing various concentrations of caspofungin were incubated with biomaterials for 1 hat 35°C. Nonadherent cells were removed by careful rinsing catheter discs with sterile PBS and then resuspended in Sabouraudglucose broth, followed by overnight incubation at 35°C. (ii) In order to assay the effect of caspofungin on biofilm formation, theyeast suspensions in Sabouraud glucose broth containing various concentrations of caspofungin were incubated with biomaterialsfor 24 h at 35°C. Nonadherent cells were removed by careful rinsing catheter discs with sterile PBS and then resuspended in freshSabouraud glucose broth. Medium changing and catheters washing procedures after overnight incubation at 35°C were repeatedthrice (total incubation period lasted 72 h). (iii) In order to assay the effect of caspofungin on biofilm eradication, the maturebiofilms were incubated in the presence of various concentrations of caspofungin for 24 h. In all assays a drop of 1% MTT solutionwas added to each dish. After incubation for 24 h at 35°C, in the presence of Candida sp. viable cells tetrazolium salt was reducedto the violet tetrazolium formazan product, accompanied by violet colour of the medium. In each experiment control free-drugassays were carried out. All experiments were done in triplicates. The representative data are presented.

Results

The MICs of caspofungin for planktonic Candida sp. cells ranged from 0.008 to 0.031 mg/l (Table I).Paradoxical turbidity at the highest drug concentrations, imitating fungal growth was observed for 3 iso-lates. However, this so-called �eagle� effect was ignored for the MIC determinations according to the litera-

Fig. 1. The structure of the mature biofilm of hydro-phobic strain of C. albicans on the surface of Thoraxcatheter (after 72 h incubation). Magnification 1200x.

ture data (Bartizal and Odds, 2003; Stevens et al., 2004). TheMFCs of caspofungin for planktonic Candida sp. cells was0.008�0.062 mg/l (Table I). For 6 strains tested MFC/MICratios were = 2, while for one strain MFC/MIC = 1. It is worthnotifying that the turbidity observed at the highest drug con-centrations during the MIC readings was accompanied by thelack of fungicidal effect of caspofungin, which was revealedduring MFC determinations.

All assayed Candida sp. isolates were able to adhere bothto Thorax and Foley catheters, following by biofilm formationon both biomaterials. This was monitored by formation ofviolet tetrazolium formazan product inside and outside of thecatheters and violet coloured medium after addition of MTTsolution. The structure of the biofilm of hydrophobic strain ofC. albicans on Thorax catheter was presented in Fig. 1.

135Capsofungin activity against Candida sp.2

The minimal concentration of caspofungin preventing adhesion process on both biomaterials ranged from0.004 to 0.031 mg/l (Table II). The above data indicate that caspofungin significantly inhibited in vitro theadherence capacity of the yeasts to the biomaterials assayed at concentrations ranged from 0.5×MIC or 1×MIC.

The minimal concentration of caspofungin preventing biofilm formation ranged from 0.004 to 0.062 mg/l.In contrast, much higher minimal concentrations of caspofungin (0.25 to >8 mg/l) were needed to eradicatethe mature biofilm of Candida sp., depending also on the strain and the biomaterial used (Table III). Thetotal eradication of Candida sp. biofilms with the drug concentrations below 8 mg/l was obtained for 2 strainsonly (Table III). The above data indicate that caspofungin significantly inhibited in vitro the biofilm forma-tion capacity of the yeasts to the biomaterials assayed at concentrations ranged from 0.5×MIC to 2×MIC,while eradication of the mature biofilm required concentrations from 4×MIC to >1032×MIC.

Generally, using the Thorax catheter higher concentrations of caspofungin were needed in order toachieve the same effects on adhesion process of Candida sp. and the yeast biofilm formation as wereobtained with the Foley catheter (Table II and III).

Discussion

Candida sp. infections can be regarded as an important medical problem, especially in the immunocom-promised patients, e.g. in lung cancer patients. Additionally, according to our unpublished data, Candida sp.isolates have shown to possess a potential ability to colonize pleural drains in patients undergoing pulmonaryresection. Although C. albicans remains a predominant etiologic agent of candidiasis, other species that tendto be less susceptible to the commonly used antifungal agents such as C. krusei, C. glabrata or C. famatahave emerged as opportunistic patogens (Chandra et al., 2001; Jabra-Rizk et al., 2004).

The results presented in this paper confirmed the good inhibitory activity of caspofungin at low concen-trations against planktonic cells of Candida sp., observed also by other authors (Bachmann et al., 2002;

Table IIn vitro activity of caspofungin against planktonic cells

of Candida sp.

* In these cases the �eagle� effect was observed.

Table IIIn vitro effect of caspofungin on adhesion process

of Candida sp. to biomaterials

C. albicans hydrophilic 0.008 0.008

C. albicans hydrophobic 0.031 0.031

C. albicans hydrophobic 0.004 0.004

C. famata hydrophobic 0.008 0.008

C. famata hydrophilic 0.008 0.004

C.glabrata hydrophobic 0.031 0.031

C. krusei hydrophilic 0.008 0.008

Strain

Minimal concentration preventingadhesion process (mg/l)

Thorax catheter Foley catheterC. albicans hydrophilic* 0.015 0.031 2

C. albicans hydrophobic* 0.031 0.062 2

C. albicans hydrophobic 0.008 0.008 1

C. famata hydrophobic 0.008 0.015 2

C. famata hydrophilic* 0.008 0.015 2

C.glabrata hydrophobic 0.031 0.062 2

C. krusei hydrophilic 0.015 0.031 2

StrainMIC

(mg/l)MFC(mg/l)

MFC/MICratio

C. albicans hydrophilic 0.031 0.008 >8 8

C. albicans hydrophobic 0.062 0.015 >8 8

C. albicans hydrophobic 0.015 0.004 >8 >8

C. famata hydrophobic 0.015 0.015 >8 >8

C. famata hydrophilic 0.015 0.004 8 8

C. glabrata hydrophobic 0.062 0.062 2 0.25

C. krusei hydrophilic 0.015 0.015 2 0.25

Table IIIIn vitro effect of caspofungin on biofilm-embedded cells of Candida sp.

Strain

Minimal concentration preventingbiofilm formation (mg/l)

Minimal concentration eradicatingbiofilm (mg/l)

Thorax catheter Foley catheter Thorax catheter Foley catheter


Ramage et al., 2002; Bartizal and Odds, 2003; Stevens et al., 2004). The MICs and MFCs determined forthe nasopharyngeal Candida sp. isolates were lower than those reported in the literature (Bartizal et al.,2003; Stevens et al., 2004). However, such discrepancies are possible since the type of medium used inantifungal susceptibility testing is of the utmost importance. The standard medium for testing drug suscep-tibility of Candida sp. was RPMI 1640 medium, whereas Sabouraud glucose broth was used for studieson Candida sp. biofilm formation (Chryssanthou and Cuenca-Estrella, 2002; Bartizal et al., 2003). TheMFC/MIC ratio, not higher than 2 for the tested strains, confirmed the excellent in vitro fungicidal activityof caspofungin against planktonic cells of Candida sp.

Our data demonstrating in vitro anti-adherent activity of caspofungin are in accordance with those fromliterature (Soustre et al., 2004). The drug concentrations as low as the 0.5×MIC and 1×MIC were sufficientto deprive biofilm-precursor planktonic cells of Candida sp. of adherence capacity and ability to forma mature biofilm. It�s worth mentioning that these values are within the range of mean through levels ofcaspofungin in serum in humans after standard dosing � 1�2 mg/l (Letscher-Bru and Herbrecht, 2003).As shown by other authors (Bachmann et al., 2002; Kuhn et al., 2002; Ramage et al., 2002; Soustre et al.,2004), exposure of planktonic Candida sp. cells even to subinhibitory concentrations of caspofungin inhib-ited adhesion process and subsequent biofilm formation. On the other hand, all examined strains of Candidasp. became much more resistant to caspofungin when adhered to the biomaterials and embedded in themature biofilm. Eradication of sessile Candida sp. populations required much higher concentrations of theantibiotic in comparison with their free-floating counterparts. Analogous investigations also have shownthat the complete sterility of the mature Candida sp. biofilms as well as the thorough eradication of adherentcells was hard to attain (Bachmann et al., 2002; Ramage et al., 2002). Nevertheless, a significant reductionin metabolic activity in caspofungin-treated sessile yeast cells was detected by other authors (Bachmannet al., 2002; Ramage et al., 2002; Soustre et al., 2004). In addition, caspofungin-treated yeast biofilmsappeared to be less hyphal and showed minor defects in the overall biofilm architecture (Bachmann et al.,2002; Ramage et al., 2002; Soustre et al., 2004). However, Ramage et al. (2002) found that caspofunginkilled >99% of sessile cells of some strains of C. albicans within the mature biofilm at therapeuticallyattainable concentrations (0.125 mg/l and 1 mg/l). The highest concentration of caspofungin (8 mg/l) wasless efficaciuos due to paradoxical lack of fungicidal effect of caspofungin at this concentration. Therefore,in studies on the effect of caspofungin on removal of Candida sp. cells adhered to the biomaterials orembedded in the biofilm, the �eagle� effect observed in case of some yeast strains should be taken intoaccount (Bartizal and Odds, 2003; Stevens et al., 2004).

The observed in this paper differences in antifungal activity of caspofungin against catheter-associatedcells of Candida sp. depended on the type of biomaterial used. Using the Thorax catheter higher concentra-tions of the drug were needed in order to achieve the same outcomes as were obtained with the Foley catheter.

To conclude, the controversial literature data (Bachmann et al., 2002; Kuhn et al., 2002; Ramage et al.,2002; Soustre et al., 2004) and our studies concerning in vitro effect of caspofungin against sessile Candidasp. cells suggest that this antibiotic, showing good anti-adherent activity in vitro, appears to be a poten-tially effective agent rather for prophylaxis of the yeast infections associated with biomaterials but not fortheir treatment.

Acknowlegments. The part of this work was supported by a grant from European Social Found (Agreement No Z/2.06/II/2.6/09/04/U/06/04).

Literature

B a c h m a n n S.P., K. Va n d e W a l l e, G. R a m a g e, T.F. P a t t e r s o n, B.L. W i c k e s, J.R. G r a y b i l l and J.L.L o p e z - R i b o t. 2002. In vitro activity of caspofungin against Candida albicans biofilms. Antimicrob. Agents Chemother.46: 3591�3596.

B a r t i z a l C. and F.C. O d d s. 2003. Influences of methodological variables on susceptibility testing of caspofungin againstCandida species and Aspergillus fumigatus. Antimicrob. Agents Chemother. 47: 2100�2107.

C h a n d r a J., D.M. K u h n, P.K. M u k h e r j e e, L.L. H o y e r, T. M c C o r m i c k and M.A. G h a n n o u m. 2001. Bio-film formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance. J. Bacteriol. 183:5385�5394.

C h r y s s a n t h o u E. and M. C u e n c a - E s t r e l l a. 2002. Comparison of the Antifungal Susceptibility Testing Subcommitteeof the European Committee on Antibiotic Susceptibility Testing proposed standard and the E-test with the NCCLSbroth microdilution method for voriconazole and caspofungin susceptibility testing of yeast species. J. Clin. Microbiol. 40:3841�3844.

137Capsofungin activity against Candida sp.2

D o u g l a s L.J. 2002. Medical importance of biofilms in Candida infections. Rev. Iberoam. Micol. 19: 139�143.H a w s e r S.P. and L.J. D o u g l a s. 1994. Biofilm formation by Candida species on the surface of catheter materials in vitro.

Infect. Immun. 62: 915�921.J a b r a - R i z k M.A., W.A. F a l k l e r and T.F. M e i l l e r. 2004. Fungal biofilms and drug resistance. Emerg. Infect. Dis.

10: 14�19.K u h n D.M., T. G e o r g e, J. C h a n d r a, P.K. M u k h e r j e e and M.A. G h a n n o u m. 2002. Antifungal susceptibility of

Candida biofilms: unique efficacy of amphotericin B lipid formulations and echinocandins. Antimicrob. Agents Chemother.46: 1773�1780.

L e t s c h e r - B r u V. and R. H e r b r e c h t. 2003. Caspofungin: the first representative of a new antifungal class. J. Antimicrob.Chemother. 51: 513�521.

L e v i t z S.M. and D. D i a m o n d. 1985. A rapid colorimetric assay of fungal viability with the tetrazolium salt MTT. J. Infect.Dis. 152: 938�944.

L i n d a h l M., A. F a r i a s, T. W a d s t r o m and S. H j e r t e n. 1981. A new test based on �salting out� to measure relativesurface hydrofobicity of bacterial cells. Biochem. Biophys. Acta 677: 471�476.

R a m a g e G., K. Va n d e W a l l e, S.P. B a c h m a n n, B.L. W i c k e s and J.L. L o p e z - R i b o t. 2002. In vitro pharmaco-dynamic properties of three antifungal agents against preformed Candida albicans biofilms determined by time-kill studies.Antimicrob. Agents Chemother. 46: 3634�3636.

S t e v e n s D.A., M. E s p i r i t u and R. P a r m a r. 2004. Paradoxical effect of caspofungin: reduced activity against Candidaalbicans at high drug concentrations. Antimicrob. Agents Chemother. 48: 3407�3411.

S o u s t r e J., M.H. R o d i e r, S. I m b e r t - B o u y e r, G. D a n i a u l t and C. I m b e r t. 2004. Caspofungin modulates in vitroadherence of Candida albicans to plastic coated with extracellular matrix proteins. J. Antimicrob. Chemother. 53: 522�525.


Enhancement of Oil Degradation by Co-culture of Hydrocarbon Degradingand Biosurfactant Producing Bacteria

MANOJ KUMAR1*, VLADIMIR LEON, ANGELA De SISTO MATERANO and OLAF A. ILZINS

Unidad de Biotecnología del Petróleo, Centro de Biotecnología, Fundación Instituto de Estudios Avanzados (IDEA),Apartado 17606 Caracas 1015 A, Venezuela

1 Present address: Synthesis and Biotics Division, Indian Oil Corporation, Research and Development Centre,Faridabad-121007, Haryana, India

Received 14 October 2005, revised 17 February 2006, accepted 21 February 2006

A b s t r a c t

In this study the biodegradation of oil by hydrocarbon degrading Pseudomonas putida in the presence of a biosurfactant-producing bacterium was investigated. The co-culture of test organisms exhibited improved degradation capacities, ina reproducible fashion, in aqueous and soil matrix in comparison to the individual bacterium culture. Results indicate thatthe in situ biosurfactant production not only resulted in increased emulsification of the oil but also change the adhesion ofthe hydrocarbon to cell surface of other bacterium. The understanding of interactions beetwen microbes may provideopportunities to further enhancement of contaminants biodegradation by making a suitable blend for bioaugmentation.

K e y w o r d s: biodegradation, biosurfactant, co-culture, BATH assay, bioaugmentation

Introduction

Mass transfer from sorbed or insoluble phases is considered to be the rate-limiting step in biodegradationof organic contaminants because the compounds must be released to the aqueous phase prior to enteringthe microbial cell and subsequent intracellular transformation by the necessary catabolic enzymes (Deanet al., 2001). The availability of slightly soluble organic compounds can be enhanced by biosurfactants.Biosurfactants can enhance biodegradation by (i) increasing available substrate surface area (dispersion)and (ii) improving affinity of microbial cells for the substrate (Ito and Inoue, 1982; Zhang and Miller, 1994;Rahman et al., 2003; Chang et al., 2004; Bonilla et al., 2005). However, effect of biosurfactant on degra-dation is less straightforward. There are also evidences that biosurfactants may interfere with the inter-action between biosurfactant-dispersed substrates and microbial cells resulting in decreased biodegradation(Falatko and Novak, 1992).

There are several reports on improved hydrocarbon degradation by addition of biosurfactant or chemicalsurfactant (Boonchan et al., 1998; Stelmack et al., 1999; Noordman et al., 2002; Rahman et al., 2003;Kuyukina et al., 2005). However, the effect of in situ biosurfactant production by co-culture of thebiosurfactant-producing and hydrocarbon degrading bacteria on hydrocarbon degradation is relatively lessstudied (Dean et al., 2001; Van Hamme and Ward, 2001). For field bioremediation application based onbioaugmentation, addition of the biosurfactant-producing bacteria may be beneficial and more practicalthan exogenously adding purified biosurfactant. Bacterial strain designated as DHT-GL isolated in our labo-ratory from hydrocarbon contaminated soil, forms excellent emulsions between 24 and 48 h of incubationwith wide the range of hydrocarbon while other strain, 5a1, efficiently degrades pure hydrocarbons in aqueoussystem. We hypothesized that a co-culture of the two organisms will enhance hydrocarbon degradationthrough the combination of superior emulsification and degradation capabilities. In this study, we usedsimple pure cultures and co-culture to study metabolic and physiological interactions that may occur in

* Corresponding author: Manoj Kumar, e-mail: [email protected]; [email protected]; tel: + 91-129-2285611;fax: + 91-129-2286221.

140 Kumar M. et al. 2

a mixed-culture fermentation system and in soil matrix. An understanding of these interactions is necessarywhen developing treatment techniques for hydrocarbon biodegradation.

The goal of this study was to determine if biodegradation of the oil could be accelerated throughbioaugmentation with hydrocarbon degrading and biosurfactant-producing bacteria. Batch aqueous and soildegradation experiments using diesel oil as representative complex hydrocarbon, were conducted invol-ving inoculation with hydrocarbon degrading and biosurfactant producing bacterial strains separately or incombinations.

Experimental


Enrichment and isolation of bacteria. The bacterial strains were isolated by the enrichment culture technique from the soilobtained from Guanaco Asphalt Belt, Venezuela. 5 g of soil was inoculated into 100 ml of minimal salt medium (MSM) containing(g/l) Na2HPO4 � 6.0; KH2PO4 � 3.0; NH4Cl � 1.0; NaCl � 0.5; MgSO4 � 0.1 and 2.5 ml of trace element solution (pH 7.0). Traceelements solution contained (mg/l) MnCl2 × 2H2O � 23; MnCl4 × H2O � 30; H3BO3 � 31; CoCl2 × 6H2O � 36; CuCl2 × 2H2O � 10;NiCl2 × 6H2O � 20; Na2MoO4 × 2H2O � 30 and ZnCl2 � 50. Crude oil (5% w/v) was used as carbon source and incubated at 30°C or60°C on a rotary shaker (200 rpm) for 4 days. After five cycles of such enrichment, 1 ml of the culture was diluted and plated onMSM agar (2% w/v) plates containing crude oil (5% w/v) as sole carbon source and incubated at 30°C or 60°C. The bacterialcolonies obtained were further purified on Luria-Bertani (LB) agar plates. The isolated strains were stored as frozen stock culturesat �70°C in 25% glycerol.

Plasmid curing and mutagenesis. Plasmid DNA was isolated by the method of Hansen and Olsen (1978). Ethidium bromidewas used as plasmid curing agent (Guerry and Colwell,1977). Random mutagenesis using N-methyl-N�-nitro-N-nitrosoguanidinewas carried out according to Tahzibi et al. (2004) to isolate bacteria with lost ability to produce biosurfactant.

Growth on hydrocarbons: Growth in the presence of hydrocarbons was studied using liquid minimal salt medium containing0.1 g of substrate/liter. Erlenmeyer flasks (250 ml) containing 50 ml of MSM and the hydrocarbon were inoculated with 100 µlLuria-Bertani (LB) broth grown pre-culture and incubated at 30°C and 200 rpm. Growth was followed by visually observing theincrease in cell density in comparison to un-inoculated control with respective carbon source. When no difference was noticed inthe turbidity of the flask and that of the control, it was taken as no growth (�), where slight increase in turbidity was noticed it wastaken as poor growth (+). Significant increase in turbidity was taken as good growth (++) while luxuriant growth and increases inturbidity was stated as very good growth (+++).

The solid polycyclic aromatic hydrocarbons (PAHs) (except naphthalene) were dissolved in 5% (w/v) diethyl ether and sprayedon surface of MSM agar. Naphthalene was provided as crystals directly placed on the plate lid. Growth on PAHs in solid media wasconsidered positive by the formation of clear zone around the growing colonies or appearance of pigments.

Biosurfactant production: To study biosurfactant production and activity, bacteria were either grown in YPG medium (g/l):Yeast extract � 5; Peptone � 5; Glucose � 15) or in MSM containing 3% (w/v) glucose and/or 2% (w/v) hexadecane. The cultureswere incubated at 30°C and 150 rpm. After 24 h the culture broth was centrifuged at 8000 rpm for 10 min and the supernatant wasused for measurement of surface-active properties. The surface tension of the biosurfactant was measured by the Ring method usinga CSC-DuNouy Tensiometer at room temperature. Drop test and oil spread test was carried out according to Youssef et al. (2004).The emulsification activity (E24) was determined by the addition of the respective hydrocarbon (kerosene, gasoline, diesel oil, gasoil, hexadecane, and alpha methyl naphthalene) to the same volume of cell free culture broth, mixed with a vortex for 2 minutes andleft to stand for 24 h. The emulsification activity was determined as the percentage of height of the emulsified layer (mm) dividedby the total height of the liquid column (mm). To study the stability of emulsion the emulsified solutions were allowed to stand at60°C and emulsification index was analyzed at different time intervals. Surface active compounds were extracted by liquid � liquidextraction from cell free culture broth acidified with 1N HCl to pH 2.0 (Rahman et al., 2003). Supernatant fluid was mixed with anequal volume of a chloroform: methanol (2 :1) mixture. The solvent was evaporated and the material was used as crude biosurfactantand weighted to evaluate the yield. Determination of the carbohydrate content of the partially purified biosurfactant was done byanthrone reagent method at 620 nm (Spiro, 1966). Protein was assayed by the Bradford (1976) method using bovine serum albuminas standard. Lipid was analysed as described by Ilori and Amund ( 2001).

16S rRNA partial gene sequencing and bacteria identification. Bacterium total DNA was isolated according to Chen and Kuo(1993). Partial gene sequence coding for 16S rRNA was amplified by PCR using universal primers U1 (5�-CCA GCA GCC GCGGTA ATA CG-3�) corresponding to nucleotide positions 518 to 537 (forward primer) and U2 (5�-ATC GG(C/T) TAC CTT GTTACG ACT TC-3�) corresponding to nucleotide positions 1513 to 1491 (reverse primer) according to the Escherichia coli numberingsystem (Weisburg et al., 1991). The PCR were performed as described by Lu et al. (2000) using A PCT-100TM thermal cycler unit(MJ Research, Inc. USA). The PCR product was separated by agarose gel electrophoresis and visualized by SYBR® Green 1staining (Sigma, St. Louis, USA) and finally purified by using a Wizard PCR Preps Purification System (Promega Corp., USA)according to manufacturer�s instructions. DNA sequencing reaction was performed with an ABI PRISM Big Dye Terminator CycleSequencing Kit (Applied Biosystems, USA) and the sequencing products were separated by capillary electrophoresis by usinga 310 Sequencer (Perkin-Elmer Corp., Applied Biosystems, USA) according to standard procedures. Sequence data were analyzedwith DNAMAN version 5.2.9 (Lynnon BioSoft, USA) to obtain a consensus sequence. To identify the isolated bacterial strain, the16S rDNA consensus sequence was compared with 16S rRNA gene sequences from the public GenBank, EMBL, and DDBJ data-bases using the advanced gapped n-BLAST program, version 2.1. The program was run via Internet through the National Center forBiotechnology Information website (http://www.ncbi.nlm.nih.gov/blast/). Sequences with more than 98% identity with a GenBanksequence were considered to be of the same species as the highest score-matching sequence on the public sequence databases.

141Oil degradation by co-cultures of bacteria2

Degradation of oil in aqueous medium. Standard diesel oil, obtained directly from Petróleos de Venezuela (PDVSA) gasstation in Caracas, Venezuela, was used as a representative complex hydrocarbon mixture for biodegradation studies. The selectedbacterial isolates of Pseudomonas putida strain 5a1 and Pseudomonas aureginosa strain DHT-GL were inoculated into 100 mlsterile nutrient broth. The flasks were incubated and shaken at 200 rpm, for 12 h at 30°C. One ml volumes from each broth culturewere mixed to prepare mixed bacterial consortium. Individual bacterial cultures and bacterial consortium (1%) were transferred to250 ml conical flasks, each containing 100 ml of sterile defined mineral salts medium with 5% diesel (v/v). An uninoculated controlwas also studied. The influence of crude biosurfactant(s) produced by strain DHT-GL was evaluated by adding 500 mg/l crudebiosurfactant in culture medium inoculated with strain 5a1. The flasks were incubated at 30°C and shaken at 200 rpm for threeweeks. At 2-day intervals, a set of flasks was used for the enumeration of microbial population and estimation of diesel content.To extract the diesel at the timed interval, the culture broth was acidified to pH 3.0 using the 6 N HCl and was amended with 20%NaCl. The resulting solution was extracted with equal volume of ethyl acetate and extracted hydrocarbon concentration was deter-mined according to Rahman et al. (2002). A standard curve plotted using known concentration of diesel was used to estimate theamount of hydrocarbons. Degradation was estimated as difference between the initial and final concentration of the oil content inthe medium. Growth of the bacterial strains was verified by demonstrating an increase in bacterial protein concentration or increasein number of colony forming units (CFU) concomitant with a decrease in the diesel concentration.

Degradation of oil in soil medium. For diesel oil degradation tests, soil was obtained from the Campus of IDEA, Caracas,Venezuela. To equalize soil particles, the soil was airdried, passed through sieves, oven dried at 80°C for 24 hours and steamautoclaved (3 times at 121°C, 15 lbs, 15 min). Fifty grams of soil, 10 ml of the culture (separately and in combinations), 0.25%(w/w) yeast extract and 5% (v/v) standard diesel were mixed, sealed and cultivated in incubator at 30°C. An uninoculated controlwas also incubated under same conditions. To extract the total petroleum hydrocarbons (TPH), 10 g of soil was twice extractedwith ethyl acetate (2×20 ml) and analyzed for hydrocarbon according to Rahman et al. (2002) at different time intervals. Extractwas dried at room temperature by evaporation of solvents in a fume hood. After evaporation, the amount of residual TPH recoveredwas also determined gravimetrically.

Analysis of cell surface hydrophobicity. The bacterial adhesion to hydrocarbons (BATH) assay was used in order to test thehydrophobicity of the two strains (Rosenberg and Rosenberg, 1985). Bacterial cells were harvested from growth culture by cen-trifugation at 8000×g for 10 min at 4°C and washed twice. The cells were then resuspended in a buffer salts solution (pH 7.0)containing (g/l) 16.9 of K2HPO4, 7.3 of KH2PO4, 1.8 of urea, and 0.2 g MgSO4 × 7H2O to give an optical density (OD) at600 nm = 1.0. Cells (4.0 ml) and hexadecane (1.0 ml) were mixed in a screw-top test tube and the test tube was vortexed for 1 min.After vortexing, the hexadecane and aqueous phases were allowed to separate for 45 min. The aqueous phase was then carefullyremoved with a Pasteur pipette, and the turbidity of the aqueous phase at 600 nm was measured. Hydrophobicity is expressed as thepercentage of adherence to hexadecane, which is calculated as follows: 100 x (1 � OD of the aqueous phase/OD of the cell suspension).

Results

Isolation and identification of bacteria. From the enrichment culture established at 30°C several bacte-rial strains were obtained. Essentially on the basis of its ability to grow on various hydrocarbons, strain 5a1was selected for further studies. Like wise from the enrichment at 60°C, one strain DHT-GL, was selectedfor further study because of its ability to produce efficient biosurfactant and growth at wide temperaturerange (manuscript under preparation). Taxonomical identification of these organism, designated as strain5a1 and strain DHT-GL, was performed by amplification and sequencing the 16S rRNA genes and comparingthem to the database of known 16S rRNA sequences. Alignment of the 16S rRNA gene sequences of strain 5a1with sequences obtained by doing a Blast searching revealed maximum similarity to Pseudomonas putida,while the strain DHT-GL resembles Pseudomonas aeruginosa.

Growth on hydrocarbons. Bacterial strains were tested for its ability to grow on variety of carbonsource including various low and high molecular weight PAHs as well as other simple aromatic hydrocar-bons and n-alkanes (Table I). These chemicals represent the most common organic pollutants and are themain components of crude oils. Strain 5a1 grows very efficiently on diverse hydrocarbons and within24 hours maximal growth was observed. In comparison strain DHT-GL grows slow and it takes around24 hours to show the visible growth in liquid and solid media. When colonies were grown on PAHs coatedagar plates, zone of the clearing appeared, indicating PAH degradation. In the presence of dibenzothiopheneon plate as well as in liquid media bacterium 5a1 produced orange or reddish brown product(s) (Kodamaet al., 1973), while no pigmentation was observed in the case of strain DHT-GL. Beside that 5a1 can alsogrow in the model crude oil containing 200 ppm of each: pyrene, dibenzothiophene, phenanthrene,hydroxyquinolone and 50 ppm of hexadecane dissolved in alpha-methyl-naphthalene (data not shown).Results shows that strain 5a1 can effectively grow in wide range of the pure hydrocarbons but grew poorlyin diesel. In comparison the strain DHT-GL grew in hydrocarbon less effectively. The cured strain of 5a1lost its ability to grow on PAHs and alkanes used in this study. This indicates that the hydrocarbon degradingability of the 5a1 was plasmid mediated. There are several reports describing plasmid mediated hydrocarbondegradation (van Hamme et al., 2003; P³aza et al., 2005)

Biosurfactant production. In contrary to 5a1 the strains DHT-GL give positive result in drop collapseand oil spreading test. These qualitative test are indicative of the surface and wetting activities (Youssef et al.,


2004). The strain DHT-GL was capable of the surface reduction on YPG media from 54.9 to 30.4 dN/cm incomparison to 49.4 dN/cm by strain 5a1 after 96 hours of growth. Interestingly, most of the surface activityof the strain DHT-GL was confined to the culture supernatant, while almost no significant potential ofsurface activity was observed for the cells. Moreover, no significant effect was observed on the activityof the extracellular biosurfactant when it was autoclaved. Emulsification activities of the culture supernatantwere measured with several water immiscible substrates. The results show that culture supernatant has highemulsification activities against diesel oil (78 ± 4%), kerosene (74 ± 3%), gas oil (76 ± 5%) and gasoline(62 ± 5%). The emulsification activity for the mixture of n-hexadecane and 2-methylnaphthalene (100%)was better than that for hexadecane (82 ± 4%) alone and almost the same as of the 2-methylnaphthalene(80 ± 5%) alone. These findings are in agreement with the results of Kalpan and Rosenberg (1982) whoreported that a mixture of aliphatic and aromatic hydrocarbons was required for maximum emulsion forma-tion. Similar finding were obtained when the culture supernatant obtained from growth of strain DHT-GLin MSM containing glucose and/or hexadecane as carbon source, was analyzed for various tests relatedto surface activity (data not shown). No significant change in emulsification index was noticed up to 48 hwhen the emulsion was in 60°C (data not shown). Highest emulsification activity and biosurfactant produc-tion (10.05 g/l) was obtained in YPG after 96 hours of growth. No protein was detected in partially purifiedbiosurfactant, which however contained lipid and carbohydrate, therefore putatively was classified as a glyco-lipid. Pseudomonas aeruginosa is well known to produce biosurfactant of glycolipid type. Several types ofthe rhamnolipids biosurfactant produced by P. aeruginosa are well characterized and studied (Banat et al.,2000). The function of biosurfactant for microbial cell is not fully understood. However, there has beenspeculation about their involvement in emulsification of water-insoluble substrates. Direct contact of cells withhydrocarbon droplets and their interaction with emulsified droplets has been described. The biosurfactant-mediated solubilization of the hydrocarbon can be helpful for bacteria to increase bioavailibity by enhancingthe solubility of the water insoluble compounds (Koch et al., 1991; Carrillo et al., 1996; Wei et al., 2005)

Synergistic effects of co-culture on oil emulsification. We observed the physical state of oil in shakeflasks containing strain 5a1, DHT-GL, or a co-culture of the two. The strain DHT-GL culture passed througha stage (24 to 48 h) where emulsification occurred and the co-culture produced a similar but more stableemulsion. The lack of emulsification in case of strain 5a1 was noticed. Emulsification activity is an indicatorused extensively to quantify biosurfactant produced by bacteria (Rahman et al., 2003). We detectedbioemulsifiers with a kerosene-water emulsification assay during the growth of the individual bacteria andtheir co-culture in degradation assay (Fig. 1). Detection of biosurfactant in strain DHL-GH occurred for thefirst time in 2nd day showing E24 26 ± 2% for culture supernatant. The peak of biosurfactant production wasobtained on 7th day with E24 value 74 ± 3%. After one-week cultures on diesel of strain 5a1 had an emulsifi-cation value of 14 ± 1%. In case of co-culture detection of biosurfactant occurred for the first time in 2nd dayshowing E24 30 ± 2% and the peak of biosurfactant production was obtained on 8th day with E24 value79 ± 4%. This indicates that strain DHT-GL produced biosurfactants in co-culture condition. The additionof crude biosurfactant caused stable emulsion formation after few hours of shaking (data not shown).

Oil degradation by co-culture and biosurfactant addition. The effect of biosurfactant producing bac-teria on biodegradation of diesel oil by strain 5a1 was investigated in aqueous and soil system. Figure 2Adepicts the time dependent increase in protein content and concomitant decrease in the hydrocarbon content

Table ISubstrate profile of the strain DHT-GL and 5a1 after 24 h in liquid medium

* Orange pigmentation in liquid as well as solid medium.** Produces blue colonies

5a1DHT-GLSubstrate

Indole � +++**

Alpha-methyl-naphthalene � +++

n-decane + ++

Toluene � ++

Octadecane + ++

Carbazole � ++

Decalin � ++

Substrate degradation ability of the isolated bacteria was also confir-med by growing them in the agar plates containing respective hydro-carbon as a sole carbon source

Naphthalene + +++

Phenanthrene + +++

Pyrene + +++

Dibenzothiophene + +++*

Phenol � ++

Ethanol � ++

Hexadecane + ++

Substrate DHT-GL 5a1


in aqueous system while Figure 2B shows the diesel degradation in the soil. It showed that co-cultureenhanced the degradation of diesel than compared with the individual strain. The maximum extent of degra-dation by strain 5a1, DHT-GL and co-culture is 44 ± 2%, 24 ± 1% and 92 ± 3%, respectively, after 20 daysin liquid media while this was 38 ± 2%, 20 ± 1% and 80 ± 4% in case of soil matrix. Co-inoculation with thebiosurfactant-producing bacterium (P. aeruginosa strain DHT-GL) in soil matrix enhanced both the rate andthe extent of diesel degradation by P. putida strain 5a1. After 20 days of incubation the total degradation bythe co-culture was higher than the arithmetic sum of the degree of degradation by individual microbe. Whenthe crude biosurfactant was added with strain 5a1 in aqueous medium, after 20 days around 85 ± 2% degra-dation in diesel oil content was observed. However, no significant impact of biosurfactant addition wasobserved in case of strain DHT-GL. A primary goal for conducting parallel experiments with exogenously

ime (d▲

Emulsion index (CC)

Emulsion index (5a1)

Emulsion index (DHT-GL)

▲ ▲▲

▲▲

▲ ▲

0 5 10 15 20

100

75

50

25

0

Em

ulsi

on in

dex

(E24

)

Fig. 1. Biosurfactant production during growth in aqueous medium containing diesel oil.Values are average of three cultures.

Time (days)

Fig. 2. Diesel degradation and bacterial growth in aqueous (A) and in soil (B) matrix.

Relative activity obtained from the calculations (actual diesel conc./intitial diesel conc.)used to compare the diesel oil degrading efficiencies of the individual bacteria andco-culture (CC). Each value represents the mean of three samples with standard error <5%.

0 4 8 12 16 20

100

80

60

40

20

0

Pro

tein

(m

g/l)

1.2

1

0.8

0.6

0.4

0.2

0

Time (days)

Rel

ativ

e ac

tivi

ty (

C/C

o)

▲

▲

▲

▲

▲ ▲

×

××

××

×

A

Control5a1DHT-GLCC5al (Protein, mg/l)DHT-GL (Protein, mg/l)CC (Protein, mg/l)

▲×

5a1CCCfu/g DHT-GL×▲

ControlDHT-GLCfu/g 5a1Cfu/g CC

60

50

40

30

20

10

00 4 8 12 16 20

8

7

6

5

4

3

2

1

0

Die

sel (

mg/

g so

il)

Bio

mas

s (C

fu/g

soi

l, 1.

0 +

E)

Time (days)

▲

▲

▲▲

▲

××

×

××

▲

×

B

✪

✪

✪

✪

✪

✪

✪


added biosurfactant was to check the hypothesis where P. aeruginosa strain DHT-GL would be releasingbiosurfactant in co-inoculated experiments. The degradation patterns in aqueous co-inoculated experimentswas reproduced by adding biosurfactant suggesting that biosurfactant produced by strain DHT-GL wasresponsible for the enhanced diesel degradation.

When the strain DHT-GL was co-inoculated with the cured strain of the strain 5a1, we could not find anysignificant enhancement in the degradation (27 ± 2%) but we could get E24 69 ± 2%. This indicates thatpossible interaction of two microbes is responsible for the enhancement of the degradation and strain 5a1plays important metabolic role in the degradation of the diesel. When the mutant strain of the DHT-GLunable to produce biosurfactant was co-inoculated with strains 5a1, no enhancement of degradation as wellas poor emulsification was observed, indicating possible role of the biosurfactant production in enhance-ment of degradation. This was further supported by enhancement of diesel degradation by the addition ofcrude biosurfactant. Abalos et al. (2004) also reported that addition of rhamnolipids produced by Pseudomo-nas aeruginosa AT10 accelerated the biodegradation of total petroleum hydrocarbons from 32% to 61% at10 days of incubation.

Analysis of cell surface hydrophobicity. The strain DHT-GL has higher cell hydrophobicity (55%)than the 5a1 (29%). When both grown in co-culture the hydrophobicity of the mix culture increased to 68%,what is more than the hydrophobicity of the individual bacterium. This indicates that biosurfactant producedby the DHT-GL cause alteration in the cell hydrophobicity and increased cell affinity for hydrophobicsubstrate. Strain 5a1 cells growing in presence of hexadecane (2%) and glucose (2%) was collected bycentrifugation, incubated (1% w/v) with the supernatant of strain DHT-GL (hexadecane and glucose ascarbon source) for 4 hours in shaking condition and then BATH assay was carried out. We found enhancedhydrophobicities (around 29% increased) in the treated cells in comparison to the untreated cells. But whenDHT-GL was incubated with 5a1 supernatant only little (7%) improvement was noticed. Similar findingwas observed when the cells were incubated with crude biosurfactant (data not shown) further indicatingthat the biosurfactant not only increased bioavailability of hydrocarbon by emulsifying the hydrocarbon butalso increased cell affinity for hydrophobic substrate by altering the cell surface. Wouter and Dick (2002)found increased biodegradation of long-chains alkanes by addition of rhamnolipids, probably due to in-creased cell surface hydrophobicity of cellular envelope by rhamnolipids. P³aza et al., 2005 isolated twobacteria from oil contaminated soil showing adhesion to hydrocarbon and bioemulsifiers production.

Discussion

The co-culture of test organisms, strain DHT-GL and 5a1 and addition of crude biosurfactant exhibitedimproved degradation capacities in both soil and aqueous systems in a reproducible fashion. The emulsifica-tion studies shows that the Pseudomonas aeruginosa produces the biosurfactant under experimental condition.It is likely that the surfactant in some way enhanced cell-cell interactions or change the surface propertiesof each other or increased bioavailability which resulted in an increased rate and extent of diesel degrada-tion. Lower diesel oil degradation in microcosms inoculated with cured strain of 5a1, suggested that thebiosurfactant-producing strain contributed to diesel oil degradation through an indirect mechanism ratherthan degrading diesel directly and the strain 5a1 play important role in the degradation. The results of thisstudy, although preliminary, illustrate species-specific commensal interactions between contaminant-degrad-ing and surfactant-producing bacteria resulting in the overall enhancement of diesel degradation. Enhance-ment of diesel oil degradation by addition of crude biosurfactant ruled out the fact that the improved dieseldegradation was due to synergistic catabolic routes in the two test strains rather than due to enhanced cell-cell interactions or increased diesel bioavailability. The overall impact of addition of a surfactant on biodeg-radation depends on how the basic diffusion pathways are altered and whether the surfactant itself affectsthe cells. If the surfactant is neither toxic nor a growth substrate, it can either increase the rate of biodegrada-tion by carrying hydrocarbons in relatively accessible micelles or it can decrease the rate by inhibiting theadhesion of cells to the hydrocarbon-water interface. The overall impact depends on the importance of eachpathway. The presence of surfactants at concentrations above the critical micelle concentration does inhibitadhesion of bacteria to the surfaces of droplets of liquid hydrocarbons and thus inhibits biodegradation(Ortega-Clavo and Alexender, 1994). Surfactant can dissolve hydrocarbon by forming the micelles intoaqueous solution (Rosenberg and Rosenberg, 1981). Direct interactions between cells and micelles can occur.A number of species of bacteria are able to degrade liquid hydrocarbons after adhering to the surfaces ofdroplets (Dahlback et al., 1981; Rosenberg and Rosenberg, 1985; Malachowsky et al., 1994). This direct


contact between a bacterial cell and a target hydrocarbon can significantly increase the rate of diffusioninto the cell, thereby enhancing growth and increasing the apparent rate of dissolution of the hydrocarbon.Surfactants are known to change the surface property of the hydrocarbon degrading bacteria and resultingin altered degradation of the contaminant (Neu, 1996; Stelmack et al., 1999; Zinjarde and Pant, 2002).The sorption of surfactants to bacteria and to interfaces can either enhance or inhibit adhesion, dependingon the nature of the surfaces and the surfactant itself. Recently, Calfee et al., 2005 demonstrated importanceof a bacterial surfactant in the solubilization and bioactivity of a cell-to-cell signal. The alterations of sur-faces depend only on the concentration of free surfactant. Results from the present study indicates that thebiosurfactant produced by one bacteria not only emulsify the oil but also change the adhesion of the hydro-carbon to cell surface and result in the increased degradation of the diesel oil.

Literature

A b a l o s A., M. V i n a s, J. S a b a t e, M.A. M a n r e s a and A.M. S o l a n a s. 2004. Enhanced biodegradation of Casablancacrude oil by a microbial consortium in presence of a rhamnolipid produced by Pseudomonas aeruginosa AT10. Biodegrada-tion 15: 249�260.

B a n a t I.M., R.S. M a k k a r and S.S. C a m e o t r a. 2000. Potential commercial applications of microbial surfactants. Appl.Microbiol. Biotechnol. 53: 495�508.

B o n i l l a M., C. O l i v a r o, M. C o r o n a, A. Va z q u e z and M. S o u b e s. 2005. Production and characterization of a newbioemulsifier from Pseudomonas putida ML2. J. Appl. Microbiol. 98: 456�463.

B o o n c h a n S., M.L. B r i t z and G.A. S t a n l e y. 1998. Surfactant-enhanced biodegradation of high molecular weight poly-cyclic aromatic hydrocarbons by Stenotrophomonas maltophilia. Biotechnol. Bioenginer. 59: 482�494.

B r a d f o r d M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the prin-ciple of protein dye binding. Anal. Biochem. 72: 248�254.

C a l f e e M.W., J.G. S h e l t o n, J.A. M c C u b r e y and S. P e s c i. 2005. Solubility and bioactivity of the Pseudomonasquinolone signal are increased by a Pseudomonas aeruginosa-produced surfactant. Infect. Immun. 73: 878�882.

C a r r i l l o P.G., C. M a r d a r a z, S.I. P i t t a - A l v a r e z and A.M. G i u l i e t t i. 1996. Isolation and selection of biosurfactantproducing bacteria. World J. Microbiol. Biotechnol. 12: 82�84.

C h a n g J.S., M. R a d o s e v i c h, Y. J i n and D.K. C h a. 2004. Enhancement of phenanthrene solubilization and biodegrada-tion by trehalose lipid biosurfactants. Environ.Toxicol. Chem. 23: 2816�2822.

C h e n W.P. and T.T. K u o. 1993. A simple and rapid method for the preparation of gram-negative bacterial genomic DNA.Nucleic Acids Res. 21: 2260.

D a h l b a c k B., M. H e r m a n s s o n, S. K j e l l e b e r g and B. N o r k r a n s. 1981. The hydrophobicity of bacteria an impor-tant factor in their initial adhesion at the air-water interface. Arch. Microbiol. 128: 267�270.

D e a n S.M., Y. J i n, D.K. C h a, S.W. W i l s o n and M. R a d o s e v i c h. 2001. Phenanthrene degradation in soils co-ino-culated with phenanthrene-degrading and biosurfactant-producing bacteria. J. Environ. Qual. 30: 1126�1133.

F a l a t k o D.F. and J.T. N o v a k. 1992. Effects of biologically produced surfactants on the mobility and biodegradation ofpetroleum hydrocarbons. Water Environ. Res. 64: 163�169.

G u e r r y P. and R.R. C o l w e l l. 1977. Isolation of cryptic plasmid deoxyribonucleic acid from Kanagawa positive strains ofVibrio parahemolyticus. Infect. Immunol. 16: 328�334.

H a n s e n J.B. and R.H. O l s e n. 1978. Isolation of large bacterial plasmids and characterization of the P2 incompatibility groupplasmids pMG1 and pMG5. J. Bacteriol. 135: 227�238.

I l o r i M.O. and D.I. A m u n d. 2001. Production of a peptidoglycolipid bioemulsifier by Pseudomonas aeruginosa grown onhydrocarbon. Z. Naturforsch. C. 56: 547�552.

I t o S. and S. I n o u e. 1982. Sophorolipids from Torulopsis bombicola: possible relation to alkane uptake. Appl. Environ.Microbiol. 43: 1278�1283.

K a p l a n N. and E. R o s e n b e r g. 1982. Exopolysaccharide distribution of and bioemulsifier production by Acinetobactercalcoaceticus BD4 and BD413. Appl. Environ. Microbiol. 44: 1335�1341.

K o c h A., O. K a p p e l i, A. F i e c h t e r and J. R e i s e r. 1991. Hydrocarbon assimilation and biosurfactant production inPseudomonas aeruginosa mutants. J. Bacteriol. 173: 4212�4219.

K o d a m a K., K. U m e h a r a, K. S h i m i z u, S. N a k a t a m i, Y. M i n n o d a and K. Ya m a d a. 1973. Identification ofmicrobial products from dibenzothiophene and its proposed oxidation pathway. Agric. Biol. Chem. 37: 45�50.

K u y u k i n a M.S., I.B. I v s h i n a, S.O. M a k a r o v, L.V. L i t v i n e n k o, C.J. C u n n i n g h a m and J.C. P h i l p. 2005.Effect of biosurfactants on crude oil desorption and mobilization in a soil system. Environ. Int. 31: 155�161.

L u J.J., C.L. P e r n g, S.Y. L e e and C.C. W a n. 2000. Use of PCR with universal primers and restriction endonucleasedigestions for detection and identification of common bacterial pathogens in cerebrospinal fluid. J. Clinical Microbiol. 38:2076�2080.

M a l a c h o w s k y K.J., T.J. P h e l p s, A.B. T e b o l i, D.E. M i n n i k i n and D.C. W h i t e. 1994. Aerobic mineralization oftrichloroethylene, vinyl chloride, and aromatic compounds by Rhodococcus species. Appl. Environ. Microbiol. 60: 542�548.

N e u T.R. 1996. Significance of bacterial surface-active compounds in interaction of bacteria with interfaces. Microbiol. Rev. 60:151�166.

N o o r d m a n W.H., J.H. W a c h t e r, G.J. D e B o e r and D.B. J a n s s e n. 2002. The enhancement by surfactants of hexa-decane degradation by Pseudomonas aeruginosa varies with substrate availability. J. Biotechnol. 94: 195�212.


O r t e g a - C a l v o J.J. and M. A l e x a n d e r. 1994. Roles of bacterial attachment and spontaneous partitioning in the biodegra-dation of naphthalene initially present in nonaqueous-phase liquids. Appl. Environ. Microbiol. 60: 2643�2646.

P ³ a z a G.A., K. U l f i g and R.L. B r i g m o n. 2005. Surface active properties of bacterial strains isolated from petroleumhydrocarbon-bioremediated soil. Polish J. Microbiol. 54: 161�167.

R a h m a n K.S.M., I.M. B a n a t, J. T h a h i r a, T. T h a y u m a n a v a n and P. L a k s h m a n a p e r u m a l s a m y. 2002.Bioremediation of gasoline contaminated soil by a bacterial consortium amended with poultry litter, coir pith and rhamnolipidbiosurfactant. Bioresour. Technol. 81: 25�32.

R a h m a n K.S.M., T.J. R a h m a n, Y. K o u r k o u t a s, I. P e t s a s, R. M a r c h a n t and I.M. B a n a t. 2003. Enhanced bio-remediation of n-alkane in petroleum sludge using bacterial consortium amended with rhamnolipid and micronutrients.Bioresour. Technol. 90: 159�168.

R o s e n b e r g M. and E. R o s e n b e r g. 1981. Role of adherence in growth of Acinetobacter calcoaceticus RAG-1 on hexa-decane. J. Bacteriol. 148: 51�57

R o s e n b e r g M. and E. R o s e n b e r g. 1985. Bacterial adherence at the hydrocarbon-water interface. Oil Petrochem. Pollut. 2:155�162.

S p i r o R.G. 1966. Analysis of sugars found in glycoproteins. Methods Enzymol. 8: 7�9.S t e l m a c k P.L., M.R. G r a y and M.A. P i c k a r d. 1999. Bacterial adhesion to soil contaminants in the presence of surfac-

tants. Appl. Environ. Microbiol. 65: 163�168.T a h z i b i A., F. K a m a l and M.M. A s s a d i. 2004. Improved production of rhamnolipids by a Pseudomonas aeruginosa

mutant. Iran. Biomed. J. 8: 25�31.Va n H a m m e J.D. and O.P. W a r d. 2001. Physical and metabolic interactions of Pseudomonas sp. strain JA5-B45 and

Rhodococcus sp. strain F9-D79 during growth on crude oil and effect of a chemical surfactant on them. Appl. Environ.Microbiol. 67: 4874�4879.

Va n H a m m e J.D., A. S i n g h and O.P. W a r d. 2003. Recent advances in petroleum microbiology. Microbiol. Mol. Biol. Rev.67: 503�549.

W e i Q.F., R.R. M a t h e r and A.F. F o t h e r i n g h a m. 2005. Oil removal from used sorbents using a biosurfactant. Bioresour.Technol. 96: 331�334.

W e i s b u r g W.G., S.M. B a r n s, D.A. P e l l e t i e r and D.J. L a n e. 1991. 16S ribosomal DNA amplification for phylogeneticstudy. J. Bacteriol. 173: 697�703.

W o u t e r H.N. and B.J. D i c k. 2002. Rhamnolipid stimulate uptake of hydrophobic compounds by Pseudomonas aeruginosa.Appl. Environ. Microb. 68: 4502�4508.

Yo u s s e f N.H., K.E. D u n c a n, D.P. N a g l e, K.N. S a v a g e, R.M. K n a p p and M.J. M c i n e r n e y. 2004. Comparisonof methods to detect biosurfactant production by diverse microorganisms. J. Microbiol. Methods 56: 339�347.

Z h a n g Y. and R.M. M i l l e r. 1994. Effect of a Pseudomonas rhamnolipid biosurfactant on cell hydrophobicity and biodegrada-tion of octadecane. Appl. Environ. Microbiol. 60: 2101�2106.

Z i n j a r d e S.S. and A. P a n t. 2002. Emulsifier from a tropical marine yeast, Yarrowia lipolytica NCIM 3589. J. Basic Microbiol.42: 67�73.


Biotransformation of Phosphogypsum on Distillery Decoctions(preliminary results)

DOROTA WOLICKA and W£ODZIMIERZ KOWALSKI

Institute of Geochemistry, Mineralogy and Petrology, Faculty of Geology, University of Warsaw,Al. ¯wirki i Wigury 93, 02-089 Warsaw, Poland

Received 16 January 2006, revised 31 March 2006, accepted 3 March 2006

A b s t r a c t

The paper presents the activity of anaerobic bacterial communities isolated from soil polluted by aircraft fuel on distill-ery decoctions with phosphogypsum. The microorganisms were selected using the microcosms method, and thenenriched on Postgate medium with ethanol. The isolated communities became the inoculum to establish a cultureon potato and rye distillery decoctions. The obtained results show that a simultaneous removal of two industrialwastes such as phosphogypsum and distillery decoctions is possible. The introduction of a inoculation comprisinga selected anaerobic bacterial community into the culture does not influence the increase of the biotransformationprocess efficiency.

K e y w o r d s: biotransformation, sulphate reducing bacteria, distillery decoctions

Introduction

Phosphogypsum represents industrial waste originated during the production of phosphoric acid fromapatites or phosphorites. Phosphogypsum is composed mainly of gypsum (CaSO4×2H2O), accompanied bybassanite (CaSO4×0.5H2O). The mineralogical characteristic of phosphogypsum was presented by Kowalskiet al. (1990). Phosphogypsum, containing about 50% sulphates, undergoes biotransformation in culturesof sulphate reducing bacteria (Przytocka-Jusiak et al., 1995). Sulphate reducing bacteria (SRB) are hetero-trophic and absolute anaerobes, using sulphates as well as other oxidised sulphur compounds (sulphites,tiosulphites, tritronians, tertrationians, elementary sulphur) as the final electron acceptors in respirationprocesses (Postgate, 1984; Gibson, 1990).

Equally hazardous wastes as phosphogypsum are fluid organic wastes, e.g. distillery decoctions. Theyoriginate during the production of ethyl alcohol from rye and potatoes. In order to be applied, as the fluidphase to dissolute phosphogypsum, fluid organic wastes should contain organic compounds available forthe SRB; nitrogen and a low content of sulphates. The main organic components of decoctions are proteins,pectines, cellulose and fibres (Mayer and Hillebrandt, 1997). They represent a group of organic compoundsrather poorly available for the SRB due to the fact that the sulphate reducing bacteria do not produce hydro-lytic enzymes. At present the only one species of SRB, Archeoglobus fulgidus is known to take part in thehydrolysis process, as it produces amylase (Labes and Schonheit, 2002). The organic components of distillerydecoctions after initial fermentation by the accompanying microflora undergo transformations into alcoholsor organic acids, being a good source of carbon for SRB (Szewczyk and Pfennig, 1990). The simultaneousbiodegradation of two industrial wastes such as phosphogypsum and distillery decoctions would be aninteresting solution from the economical point of view. Costs linked with simultaneous biodegradation oftwo industrial wastes, hazardous to the environment, are always lower than in the case of two separatebiodegradation processes.

The main focus of the presented research was obtaining a sulphidogenic microorganisms communitycontaining SRB and testing the possibility of phosphogypsum biotransformation in stationary cultures withsimultaneous treatment of distillery decoctions.

148 Wolicka D. and Kowalski W. 2

Experimental


Phosphogypsum. The studied sample of phosphogypsum was collected from a waste dump from Wizów near Boles³awiec inLower Silesia (Table IA).

Microorganisms. Community of anaerobic bacteria isolated from soil polluted by aircraft fuel and autochthonic microflorafrom distillery decoctions.

Media. (a) Modified Postgate medium (Postgate, 1984), in which Na2SO4 (4.5 g/dm3) was replaced by phosphogypsum(5.0 g/dm3). The source of carbon in the medium was ethanol (3 cm3/dm3). (b) Potato and rye distillery decoctions. The standardcomposition of distillery decoctions is presented in Table IB. Resasurine in the concentration 0.001 g/dm3 was added to all cultures.

SO3

42.18

CaO 29.61

P2O

52.24

SrO 1.62

SiO2

0.65

F 0.5

Al2O

30.24

Na2O 0.37

Fe2O

30.14

K2O 0.10

BaO 0.03

MgO 0.05

H2O cryst. 20.18

Table IChemical composition of phosphogypsum (A) and distillery decoctions (B)

A. Phosphogypsum B. Distillery decoctions

Component (% weight) Kowalski et al. (1990) � Wizów Component (% weight) potato rye

dry mass 5.6 8

ash 0.7 0.3�0.5

starch � �

other polysaccharides 2.9�3.2 4.0�4.5

fibres 0.4�0.7 0.5�1.1

proteins 1.2�1.5 1.7�3.5

fats 0.04 0.5

Culture conditions. The cultures were enriched in 100 or 300 cm3 volume bottles, tightly sealed with rubber plugs, withpermanently attached needles with syringes. The relation of the inoculum to the medium was 1:10. The cultures were incubated intemperature of 30° or/and 55°C.

Enrichment of microorganisms. The microorganisms were enriched from soil polluted by aircraft fuel using the microcosmmethod. The soil suplemented with phosphogypsum (5 g/dm3) was placed in 100 cm3 boxes, and next the Postgate medium withethanol was added as the only source of carbon. The boxes were tightly sealed and incubated for 6 weeks in temperature of 30° and55°C in order to select anaerobic sulphidogenic consortions able to biotransform phosphogypsum.

Measurements. The following parameters were determined in the cultures: sulphides using the iodometric method, sulphatesusing the bar method and emission spectrometry method (induction excitation in an ICP medium), COD using the bi-chromatemethod. The reaction (pH) of the culture was corrected using 0.1N HCl or 0.1N NaOH.

The post-culture deposits were analysed with the radiography method using a DRON-2 diffractometer.


Isolation and enrichment of SRB from soil polluted by aircraft fuel. The most characteristic environ-ments in which SRB occur are marine sediments (Boopathy et al., 1998; Kuever et al., 1999), where theconcentration of sulphates typically reaches an average of 28 mM (de Wit, 1992), oil fields and oil reser-voirs (Voordouw et al., 1996; Telang et al., 1997; Jenneman and Gevertz, 1999; Magot et al., 2000; Giegand Suflita, 2002), as well as environments polluted by oil-derived products (Wolicka and Kowalski, 2005).The analyses were preceeded by the enrichment of an active community of anaerobic microorganisms inconditions favouring the selection of SRB.

The microorganisms were isolated from soil polluted by aircraft fuel. After 6-week incubation, the en-richment of selected anaerobic communities of microorganisms began on a Postgate medium with ethanoland phosphogypsum. The obtained sulphidogenic microorganisms community (ethanol community) waspassaged 5 times. Each passage lasted for 14 days. The maximal content of sulphides, 720 mg HS�/dm3,

149Biotransformation of phosphogypsum2

was observed in the 4th passage of the culture, what corresponded to the reduction of 2030 mg SO4/dm3, i.e.46% of phosphogypsum introduced into the medium (Fig. 1).

Enrichment of bacterial communities on distillery decoctions. The isolated ethanol community wasused as the inoculum to establish cultures on potato and rye distillery decoctions. Ten cultures were estab-lished: 4 on potato distillery decoctions (P) and 4 on rye distillery decoctions (R). Control cultures (C),cultures no 5 and 10, were cultured on a Postgate medium with ethanol inoculated with the ethanol commu-nity. They were managed in two variants: with and without pH regulation in the medium. All cultures werepassaged 6 times in order to adapt the microorganisms to the distillery decoctions environment, and also inorder to select a bacterial community able to actively biotransform phosphogypsum. The obtained resultsare presented in Table II.

As shown in Table II, the activity of the selected microorganisms in the enriched cultures depends onthree factors: temperature, pH and type of decoctions. Higher concentrations of HS� were observed in cul-tures where the pH during the incubation was optimal for the SRB and reached 6.6�7 (cultures no 1 and 3).In these cultures the content of HS� reached over 380 mg HS�/dm3. In cultures no 2 and 4, in which the pHvalues were not corrected (pH 4.8�5.2) was observed lower activity of the SRB. Only some SRB can beactive in media with such pH; they include bacteria growing in acidic mine waters (Elliot et al., 1998).

Analysing the data from Table II it can be concluded that higher values of HS� were obtained in meso-philic cultures. In cultures no 1 and 3 a similar concentration of HS� was obtained � 612 and 610 mg/dm3,what corresponds to the reduction of 1726 and 1720 mg SO4/dm3 and 34.5% phosphogypsum/dm3 in rela-tion to 5 g/dm3 introduced into the medium. In cultures of thermophilic communities of microorganisms,regardless the type of applied decoctions and the pH value in the medium, high concentrations of HS�

were not observed. The maximal content of HS� � 280 mg/dm3 was observed in cultures no 6 and 8, what

Fig. 1. Maximal concentration of sulphides obtained in the following passages of the ethanol culture

1 2 3 4 5passages

HS

� m

g/dm

3

800

700

600

500

400

300

200

100

0

P 1 reg. 30 448 460 495 612 568 497

2 n. reg. 30 320 280 280 220 200 220

R 3 reg. 30 380 470 520 610 580 540

4 n. reg. 30 472 442 408 529 612 529

C 5 n. reg. 30 380 420 470 628 640 620

P 6 reg 55 220 180 240 280 220 180

7 n. reg. 55 220 180 120 120 160 180

R 8 reg 55 180 200 190 280 220 200

9 n. reg. 55 180 180 160 120 100 120

C 10 n. reg. 55 180 220 200 200 180 160

C � control cultures; reg. � pH regulation of the medium; n.reg. � without pH regulation of the medium

Table IIMaximal concentration of HS� (mg/dm3) in the following passages of the cultures on distillery

decoctions

Type ofmedium

No ofculture

pH Incubationtemp. (oC)

No of passage

1

HS� (mg/dm3)

Dec

octi

ons

2 3 4 65


corresponded to the reduction of 790 mg SO4/dm3 and 15.8% phosphogypsum/dm3 in relation to 5 g/dm3

introduced into the medium.Regardless the applied decoction (potato or rye), the activity of the isolated bacteria was comparable.Influence of the inoculum on the activity of phosphogypsum biotransformation in distillery decoc-

tions. The next stage of the study was focused on testing the influence of the applied inoculum on theeffectiveness of the phosphogypsum biotransformation process in distillery decoctions. In this case the mostactive microorganism community no 1 was used as the inoculum to establish a culture on distillery decoc-tions. Three cultures were established: 1G � on barren potato decoctions inoculated with the inoculum;2G � on non-barren decoctions inoculated with the ethanol inoculum. Culture 3G comprised non-barrennon-inoculated potato decoctions (control culture). All cultures contained phosphogypsum as the only elec-tron acceptor. The production of sulphides obtained in these cultures is shown in Fig. 2.

The increase of concentration of hydrogen sulphide was observed in all cultures. The highest concentra-tion of HS� � 488 mg/dm3 was noted in culture 3G, on non-barren non-inoculated decoctions. In 1G and 2Gsimilar values of 336 and 343 mg/dm3 of HS� were noted. This corresponded to the reduction of about 55%,38% and 39%, respectively, of phosphogypsum in relation to 5 g/dm3 introduced into the medium.

The costs linked with simultaneous biodegradation of two industrial wastes, particularly hazardous tothe environment, are always lower than for each of these wastes treated separately. Therefore, the removalof organic wastes from decoctions is equally important as the biotransformation of phosphogypsum. TheCOD of distillery decoctions was high and reached 2.2 g O2/dm3, whereas the content of sulphates wasrather low � 50 mg/dm3. Addition of phosphogypsum to distillery decoctions makes them high-sulphurwastes as in the case of wastes from the production of citric acid from sugar cane (2.9 g SO4/dm3). Thecalculated ratio COD/SO4 reached 8.8. If this ratio is higher, then more organic compounds are decomposedduring the formation of methane. At COD/SO4 >10 sulphides are not produced (Li and Humphre, 1989;Oude Elferinck et al., 1995). It is assumed that the co-existence of the two groups of microorganisms ispossible when COD/SO4 ratio is between 1.7 and 2.7; below 1.7 the SRB dominate (Clancy et al., 1992). Thereduction of COD and biotransformation of phosphogypsum in the particular cultures are presented in Fig. 3.

HS

� m

g/dm

3

800700600500400300200100

00 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

days

1G

2G

3G

Fig. 2. The content of HS� obtained in cultures of bacterial communities on distillery decoctions

Fig. 3. Reduction of COD and biotransformation of phospho-gypsum in cultures on distillery decoctions

1G 2G 3G

It can be assumed that addition of a selectedanaerobic inoculum comprising a community ofmicroorganisms to the decoctions did not increasethe effectiveness of phosphogypsum transformation.Community 3G comprising non-barren non-inocu-lated distillery decoctions most effectively took partin the biotransformation process (55% reductionof phosphogypsum) with simultaneous purificationof the distillery decoctions (24% reduced COD).Calculations showed similar results for cultures 1Gand 2G: 38% reduction of phosphogypsum andabout 13.5% reduction of COD. The activity of SRBin COD reduction was 22.7% in culture 1G, 22.2%in 2G and 17.7% in 3G. The obtained results of a ca.20% activity of SRB in the utilisation of organiccompounds are similar to those obtained by Guptaet al. (1994) in bioreactors purifying sewage.

g/dm

3

6

5

4

3

2

1

0

biotransformation of phosphogypsum

reduction of COD

151Biotransformation of phosphogypsum2

After incubation the post-culture deposits were separated. The observed reduction of the phosphogypsummass was: 15% for culture 1G (0.9 g/dm3), 2G � 20% (1 g/dm3) and 3G � 55% (2.75 g/dm3). Diffractometricanalyses did not show any substantial phase changes in the sediment in comparison to phosphogypsum.

In conclusion the community of bacteria isolated from soil contaminated by air fuel contained SRBcapable of the biotransformation of phosphogypsum. It can be also stated that the biotransformation ofphosphogypsum in cultures in distillery decoctions is possible but is not very effective and its optimizationrequires further research.

Literature

B o o p a t h y R., M. G u r g a s, J. U l l i a n and J.F. M a n n i n g. 1998. Metabolisms of explosive compounds by sulphate-reducing bacteria. Curr. Microbiol. 37: 127�131.

C l a n c y P.C., N. Ve n k a t a r a m a n and L.R. L y n d. 1992. Biochemical inhibition of sulfate reduction in batch and continuousanaerobic digesters. Wat. Sci. Technol. 25: 51�59.

E l l i o t P., S. R a g u s a and D. C a t e c h e s i d e. 1998. Growth of sulphur reducing bacteria under acidic conditions in anupload anaerobic bioreactor as a treatment system for acid mine drainage. Wat. Res. 32: 3724�3730.

G i b s o n G. 1990. Physiology and ecology of the sulphate-reducing bacteria. J. Appl. Bacteriol. 69: 769�797.G i e g L.M. and J.M. S u f l i t a. 2002. Detection of anaerobic metabolites of saturated and aromatic hydrocarbons in petroleum-

contaminated aquifers. Environ. Sci. Technol. 36: 3755�3762.G u p t a A., J.R.V. F l o r a, M. G u p t a, G.D. S a y l e s and M.T. S u i d a n. 1994. Methanogenesis and sulfate reduction in

chemostats. I. Kinetic studies and experimens. Water Res. 28: 781�793.J e n n e m a n G.E. and D. G e v e r t z. 1999. Identification, characterization and application of sulfide-oxidizing bacteria in oil

fields In Microbial Biosystems: New Frontiers. Proceedings of the 8th International Symposium on Microbial EcologyC.R. Bell, M. Brylinsky, P. Johnson-Green (ed.) Atlantic Canada Society for Microbial Ecology, Halifax, Canada.

K o w a l s k i W., J. P a r a f i n i u k and M. S t ê p i s i e w i c z. 1990. Mineralogy and geochemistry of phosphogypsum froma dump of Chemical Works �Wizów� (in Polish). Arch. Mineral. 45: 115�134.

K u e v e r J., F.A. R a i n e y and H. H i p p e. 1999. Description of Desulfotomaculum sp. Groll as Desulfotomaculum gibsoniaesp. nov. Int. J. Sys. Bacteriol. 49: 1801�1808.

L a b e s A. and P. S c h o n h e i t. 2002. Sugar utilization in the hyperthermophilic, sulphate-reducing archeon Archeoglobusflugidis strain 7324 starch degradation to acetate and CO

2 via a modified Embden-Meyerhof pathway and acetyl-CoA

syntetase (ADP-forming). Arch. Microbiol. 177: 431�432.L i J. and A. H u m p h r e y. 1980. Kinetic and Fluorometric Behaviour of a Phenol Fermentation. Bioprocess Engineering. Ellis

Horwood Limited Chichester, England. chapter 13, 190�206.M a g o t M., B. O l l i v i e r and B.K.C. P a t e l. 2000. Microbiology of petroleum reservoirs. Antonie van Leevenhoek. 77:

103�116.M a y e r F. and J.O. H i l l e b r a n d t. 1997. Potato pulp: microbiological characterisation, physical modification, and application

of this agricultural waste product. App. Microbiol. Biotechnol. 48: 435�440.O u d e E l f e r i n c k S.J.W.H., W.J.C. Vo r s t m a n, A. S o p j e s and A.J.M. S t a m s. 1995. Desulforhabdus amnigenus gen.

sp. nov., a sulphate reducer isolated from anaerobic granular sludge. Arch. Microbiol. 164: 119�124.P r z y t o c k a - J u s i a k M., W. K o w a l s k i, M. R z e c z y c k a, M. B ³ a s z c z y k and R. M y c i e l s k i. 1995. Products of

microbial transformation of phosphogypsum in anaerobic thermophilic cultures (in Polish). Biotechnologia 29: 102�112.P o s t g a t e J.R. 1984. The Sulphate Reducing Bacteria 2 nd. edition, Cambridge University Press, Cambridge.S z e w c z y k R. and N. P f e n n i g. 1990. Competition for ethanol between sulphate-reducing and fermenting bacteria. Arch.

Microbiol. 153: 470�477.T e l a n g A.J., S. E b e r t, J.M. F o g h t, D.W.S. W e s t l a k e, G.E. J e n n e m a n, D. G e v e r t z and G. Vo o r d o u w. 1997.

Effect of nitrate injection on the microbial community in an oil field as monitored by resource sample genome probing. Appl.Environ. Microbiol. 63: 1785�1793.

d e W i t R. 1992. Sulfide containing environments. In Ledeberg J. (ed.), Encyclopedia of Microbiology, Academic Press, NewYork, 105�121.

W o l i c k a D. and W. K o w a l s k i. 2005. Utilising different carbon compounds by sulphate-reducing bacteria in media withphosphogypsum. Arch. Environ. Protec. 31: 105�112.

Vo o r d o u w G., S.M. A r m s t r o n g, M.F. R e i m e r, B. F o u t s, A.J. T e l a n g, Y. S h e n and D. G e v e r t z. 1996.Characterization of 16S rRNA genes from oil field microbial communities indicates the presence of a variety of sulphate-reducing, fermentative, and sulphide-oxidizing bacteria. Appl. Environ. Microbiol. 62: 1623�1629.


Survival of Proteus mirabilis O3 (S1959), O9 and O18 Strainsin Normal Human Serum (NHS) Correlates

with the Diversity of their Outer Membrane Proteins (OMPs)

BO¯ENA FUTOMA-KO£OCH1, GABRIELA BUGLA-P£OSKOÑSKA1,W£ODZIMIERZ DOROSZKIEWICZ1 and WIES£AW KACA2

1 Institute of Genetics and Microbiology, Wroc³aw University, Przybyszewskiego 63/77, 51-148 Wroc³aw, Poland;2 Institute of Biology, �wiêtokrzyska Academy, �wiêtokrzyska 15, 25-406 Kielce, Poland

Received 27 October 2005, revised 25 March 2006, accepted 28 March 2006


A b s t r a c t

Urinary tract infections are frequently caused by Proteus mirabilis strains. In the previous studies there were definedthe complete structures of O-polysaccharide parts of lipopolysaccharides from strains: P. mirabilis O3 (S1959),P. mirabilis O9 and P. mirabilis O18. In the present study it was investigated bactericidal effect of normal human serum(NHS) to P. mirabilis strains. We also focused on the diversity of outer membrane proteins (OMPs) being separated ona gel isolated from tested strains. Serial passage of P. mirabilis O18 in 90% normal bovine serum (NBS) contributedto over-expressing some classes of OMPs.

K e y w o r d s: Proteus mirabilis, serum, the complement system, outer membrane proteins (OMPs)

Proteus mirabilis strains are a common cause of urinary tract infections and also have been described asopportunistic etiological agents in infections of the respiratory tract and of wounds, burns, skin, eyes, noseand throat diseases (Ró¿alski et al., 1997). Pathogenic bacteria have worked out many different ways toovercome the host defense system for example proteolytic degradation of secretory immunoglobulin orsteric shielding or modification of exposed pathogen-associated molecular patterns (PAMPs) (Hornef et al.,2002). One of the mechanisms which protect the macroorganism from infections is the bactericidal activityof serum. The complement system is a complex of serum proteins which interact in a cascade. It recognizesand promotes clearance, by phagocytosis, of invading microorganisms and also causes lysis of Gram-nega-tive bacteria itself. Activation of the complement system is achieved through three major pathways: theclassical pathway (CP), which is activated by certain isotypes of antibodies bound to antigens (immunecomplexes); the alternative pathway (AP), which is activated on microbial cell surfaces in the absence ofantibodies and the lectin pathway (LP), which is activated by a mannose binding lectin � MBL, that bindsto mannose residues on microbes (Sim and Tsiftsoglou, 2004). The mechanism of the bacterial resistance tothe bactericidal effect of the serum is still not fully understood, but it is known that some outer membraneproteins (OMPs) and lipopolysaccharides (LPSs) are the factors determining the resistance (Pilz et al., 1992;Prasadarao et al., 2002; White et al., 2005) or the sensitivity (Alberti et al., 1993; Merino et al., 1998;Weber et al., 1992) of bacteria to the bactericidal action of the serum.

Lipopolysaccharide (LPS, bacterial endotoxin), the major component of the outer membrane is one ofthe virulence factors of Proteus, preventing the Proteus rods against bactericidal effects of the complementproteins deposition. There are different mechanisms for LPS mediated complement activation (Vukajlovichet al., 1992). The antibody-independent classical pathway (CP) is mediated only by the lipid A portion ofthe molecule (Vukajlovich et al., 1987). Activation of the alternative pathway (AP) requires the polysac-charide moieties of LPS, core oligosaccharide and/or O-antigen polysaccharides (Vukajlovich et al., 1992;Vukajlovich et al., 1987). Previous studies tested complement activation by LPSs isolated from P. mirabilisO10, O23, O30, and O43 strains, which differ in the number of negative COO-groups on their polysaccharide

154 Futoma-Ko³och B. et al. 2

components. Four P. mirabilis strains studied were resistant to complement-mediated killing, despite of thecomplement binding by their LPSs (Kaca et al., 2000). In the other studies of two smooth P. mirabilisstrains O9 and O49 bacterial resistance to the bactericidal effect of the serum was found to be dependedon the chemical structure and polysaccharide lenght of O9 and O49 LPSs (Fuda³a and Kaca, 2004). Thecomplete structures of O-polysaccharide parts of lipopolysaccharides of studied strains were established.P. mirabilis O3 (S1959), O9 and O18 LPSs have the unique structures with lysine, furanosic-form of riboseand phosphocholine residues, respectively (Fuda³a et al., 2003; Kondakova et al., 2003; Zió³kowski et al.,1997). In the above mentioned studies the role of the outer membrane proteins in the bacterial complementmediated-resistance has not been investigated yet.

Below, we focused on electrophoretic patterns of OMPs isolated from P. mirabilis O3 (S1959), O9 andO18 strains. A correlation between the presence of some OMPs and the susceptibility of bacteria to thebactericidal activity of serum was observed.

Three strains: P. mirabilis O9, P. mirabilis O18 and P. mirabilis O3 (S1959) obtained from the CzechNational Collection of Type Cultures (Institute of Epidemiology and Microbiology, Prague, Chech Republic)and Institute of Microbiology and Immunology, University of £ód�, Poland (strain P. mirabilis O3 (S1959))were used. Normal human serum (NHS) was obtained from three healthy volunteers which had not beenpreviously treated with any antimicrobial drug. The serum samples were collected and kept frozen (�70°C)for a period no longer than 4 months. A suitable volume of serum was thawed immediately before use. Eachportion was used only once. Normal bovine serum (NBS) was obtained from five healthy animals, preparedand stored in the same way like NHS. To define bacterial sensitivity to the bactericidal serum activity themodified Doroszkiewicz method (Doroszkiewicz, 1997) was used. Briefly, the strains were grown overnight,and then bacterial cells of early exponential growth phase were transferred to a fresh nutrient broth andincubated at 37°C for 1 hour. After incubation the bacterial cells were centrifuged (4000×g, 20 min, 4°C).The bacteria were then added to 50% and 75% NHS or 90% NBS (serum was diluted with 0.1 M NaCl) andincubated in a water bath at 37°C. After 0, 60 and 180 min samples were collected, diluted and cultured onnutrient agar plates for 18 h at 37°C. The number of colony forming units (CFU) at the time zero was takenas 100%. Strains with a survival ratio not less than 50% after 180 min of incubation in NHS or NBS wereregarded as resistant. The control samples of NBS and NHS were decomplemented by heating at 56°C for30 min (Doroszkiewicz et al., 1995; Eidinger et al., 1977; Mielnik et al., 2001). The level of C3 and C4components in NHS was determined using monospecific polyclonal antibodies anti-C3 and anti-C4 proteins(Roitt and Male, 2000). Outer membrane proteins (OMPs) were isolated (Murphy and Bartos, 1989) fromthe bacteria grown in 100 ml of Brain Heart Infusion (BHI) broth (Difco) at 37°C for 18 h. P. mirabilis O18strain after serial passage in 90% NBS was also grown in BHI broth at 37°C for 18 h before the isolationprocedure. After incubation the bacterial cells were centrifuged (4000 × g, 15 min, 4°C) and the pellet wassuspended in 2.5 ml of buffer $ (1 M sodium acetate, 0.001 M $-mercaptoethanol, pH 4.0). Then 22.5 ml ofwater solution containing 5% (w/v) Zwittergent 3�14 (Calbiochem-Behring) and 0.5 M CaCl2 was added.That mixture was stirred at room temperature for 1 h. To precipitate nucleic acids a 6.25 ml volume of 96%(v/v) cold ethanol was added very slowly. The mixture was then centrifuged at 17000×g at 4°C for 10 min.The remaining proteins were precipitated by addition of 96% (v/v) cold ethanol and were centrifuged at17000×g for 20 min at 4°C. The pellet was then suspended in buffer Z (0.05% (w/v) Zwittergent, 0.05 M Trisand 0.01 M EDTA, pH 8.0) and stirred at room temperature for 1 h. The solution was kept at 4°C overnightand centrifuged at 12000×g for 10 min at 4°C. OMPs were present in the buffer Z soluble fraction aftercentrifugation. To determine a concentration of outer membrane proteins in the samples the Bradford proteinassay (Bradford, 1976) was used. Discontinuous sodium dodecyl sulfate gel electrophoresis (SDS-PAGE)was carried out on slabs with 12.5% acrylamide according to Laemmli (Laemmli, 1970). The Wide MolecularWeight Range Sigma Marker protein standard was used for molecular mass calibration. OMPs preparedin the sample buffer were loaded in each of the wells in the same volume of 10 µl. The samples consistedof almost the same amounts of protein in the range of 0.9�1.2 mg/ml. After electrophoresis the gels werekept for 1h in a solution containing 25% (v/v) methanol, 10% (v/v) acetic acid and 0.05% (w/v) CoomassieBrilliant Blue and then destained in 10% (v/v) acetic acid for 3�5 h. For the molecular analysis of OMPs theBIO-CAPT v. 99 software as well as the BIO-1D++ v.99 (Vilber Lourmat, France) were used.

The data concerning the determination of the level of C3 and C4 in NHS showed that the level of C3 was78 mg/dl (standard for a normal human serum is 55�120 mg/dl) and C4 was 37 mg/dl (standard for a normalhuman serum is 20�50 mg/dl).

To determine the killing effect of the serum on bacteria, we studied the survival of bacteria after threehours of incubation in serum. The results concerning the sensitivity of three P. mirabilis strains to NHS after

155Short communication2

180 min of incubation are given in Table I. The results presented in the Table I indicate that the strainsP. mirabilis O9 and P. mirabilis O18 were more sensitive to the bactericidal action of NHS than P. mirabilis O3(S1959) strain. The latter one was resistant to the lytic action of the serum and the number of cells increasedin 50% and 75% human serum dilution. When NHS decomplemented by heating at 56°C for 30 min wasused in the experiment, the bacteria proliferated very intensively. It confirmed that the complement wasresponsible for the killing action of NHS. The serial passage (23 times in 90% NBS) of P. mirabilis O18strain increased the level of the resistance of bacteria to the bactericidal action of 50% NHS (Table I).

Also some differences appeared in SDS-PAGE patterns of the outer membrane proteins. P. mirabilis O18treated by the sequencial passage in 90% NBS (data not shown) over-expressed some of the outer mem-brane proteins compare to P. mirabilis O18 before the passage (Fig. 1). It was observed, that OMPs with themolecular masses: 36 kDa, 35 kDa, 34 kDa, 33 kDa, 22 kDa, 21 kDa, 19 kDa, 18 kDa were present in alltested strains of P. mirabilis. Particular analysis of bands on 12.5% polyacrylamide gel have shown, thatP. mirabilis O18 after passage in 90% NBS produced some excess of proteins which were unexpectedlyrelated in their quantity to these isolated from the resistant strain P. mirabilis O3 (S1959) and the main were:22kDa, 19 kDa, 18 kDa, 17 kDa. As a result of the passage of P. mirabilis O18 in 90% NBS there appearedOMPs with the molecular masses 110 kDa, 67 kDa, 62 kDa and 34 kDa which were not produced byP. mirabilis O18 before the passage in 90% NBS. Densitometric analysis of OMPs (data not shown) was

a b c d kDa

2051169784665545

36

2924

20

14

6.5

34

22

191817

Fig.1. The SDS-PAGE patterns of outermembrane proteins (OMPs).

Lane a: outer membrane proteins isolated fromP. mirabilis O3 (S1959); Lane b: P. mirabilis O18(23 times of serial passage in 90% NBS); Lane c:P. mirabilis O18 (not passaged in 90% NBS);Lane d: Molecular Size Marker M4038 (Sigma).

P. mirabilis O3 (S1959) 3.7×106 1.2×108 2.1×106 1.1×107 4.4×106 5.3×107

P. mirabilis O9 3.3×106 3.6×103 2.3×106 3.4×102 3.6×106 3.4×107

P. mirabilis O18 (not passaged in 90% NBS) 1.8×105 7.2×103 6.1×106 4.9×105 4.3×105 2.4×107

P. mirabilis O18 (23 times passaged in 90% NBS) 3.0×106 2.5×105 3.5×106 7.3×104 4.1×106 4.0×107

Table IBactericidal activity of NHS against P. mirabilis O3 (S1959), P. mirabilis O9 and P. mirabilis O18

1 CFU/ml � colony forming units, 2 56°C/30 min � serum decomplement by the heating

Strain

CFU/ml1

Serum solution % (v/v)

50%

Time of incubation (min)

T180

T0

T180

T0

T180

T0

75% 50%2

helpful to the preliminary defining of the dependence of the sur-vival of bacteria in NHS and the presence and ratio of some outermembrane proteins. The following investigations will comprise pro-tein elution and determining the proportional contents of particularOMPs in the samples.

In the previously published papers the participation of OMPs inthe bacterial serum resistance phenomena (Cisowska et al., 2005;Futoma et al., 2004; Murphy et al., 2000; Pilz et al., 1992;Prasadarao et al., 2002) was discussed. It has been suggested thatouter membrane protein A (OmpA) of Escherichia coli contributesto serum resistance by binding to C4b binding protein (C4bp),a complement fluid phase regulator (Prasadarao et al., 2002). Inother bactericidal assays, the mutants of Moraxella catarrhalis weremore readily killed by normal human serum compared to theisogenic parent strains which possessed outer membrane protein E(OmpE). Those results indicated that OmpE was involved in the ex-pression of serum resistance (Murphy et al., 2000). Some OMPscan inhibit complement activation on the C3, C9 and C5b-9 level(Pilz et al., 1992). It has been shown that porin (OmpK36) fromKlebsiella pneumoniae activated the classical pathway of thecomplement system by forming complexes with C1q, a componentof the complement. Together with an activated complement in thealternative pathway it came to effective elimination of serum-sensi-tive K. pneumoniae cells (Alberti et al., 1993).

156 Futoma-Ko³och B. et al. 2

The presented data indicate that the serum resistance of P. mirabilis rods may be mediated by outermembrane proteins patterns in a concert with O-polysaccharides LPSs structures.

Acknowledgments. This research was partially supported by grant 2 P04C 028 28 from the State Com-mittee for Scientific Research (KBN), Poland.

Literature

A l b e r t i S., G. M a r g u e s, S. C a m p r u b i, J.M. M e r i n o, J.M. T o m a s, F. V i v a n c o and V.J. B e n e d i. 1993. C1qbinding and activation of the complement classical pathway by Klebsiella pneumoniae outer membrane proteins. Infect.Immun. 61: 852�860.

B r a d f o r d M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantitites of protein utilizing the prin-ciple of protein-dye binding. Anal. Biochem. 72: 248�254.

C i s o w s k a A., G. B u g l a - P ³ o s k o ñ s k a, A. G a m i a n, W. D o r o s z k i e w i c z and S. J a n k o w s k i. 2005. Relation-ship between susceptibility to bactericidal action of serum and outer membrane protein patterns in E. coli K1 strains. Pol.J. Environ. Stud. 14, suppl. II: 476�482.

D o r o s z k i e w i c z W. 1997. Mechanism of antigenic variation in Shigella flexneri Bacilli. IV. Role of lipopolysaccharides andtheir components in the sensitivity of Shigella flexneri 1b and its Lac+ recombinant to killing action of serum. Arch. Immun.Ther. Exp. 45: 235�242.

D o r o s z k i e w i c z W., B. K o p o c i ñ s k i and T.M. L a c h o w i c z. 1995. Mechanism of antigenic variation in Shigellaflexneri bacilli. III. Complement sensitivity of S. flexneri 1b strains and their 3b variants selected either as Lac+ recombinantsor phage F2 resistant mutants. Arch. Immun. Ther. Exp. 43: 67�72.

E i d i n g e r D., E. B e l l o and A. M a t e s. 1977. The heterocytotoxity of human serum. I. Activation of the alternative comple-ment pathway by heterologous target cells. Cell. Immun. 29: 174�186.

F u d a ³ a R. and W. K a c a. 2004. The human complement C3 and C5b-9 deposition by Proteus mirabilis O9 and O49 lipopolysac-charides. Adv. Microbiol. 25, Suppl. I.

F u d a ³ a R., A.N. K o n d a k o v a, K. B e d n a r s k a, S.N. S e n c h e n k o v a, A.S. S h a s h k o v, Y.A. K n i r e l, U. Z ä h r i n g e rand W. K a c a. 2003. Structure and serological characterization of the O-antigen of Proteus mirabilis O18 with a phospho-choline-containing oligosaccharide phosphate repeating unit. Carbohydr. Res. 338: 1835�1842.

F u t o m a B., G. B u g l a and W. D o r o s z k i e w i c z. 2004. The influence of OMP proteins on Gram-negive bacteria onbacteriocidal activity of serum (in Polish). Post. Mikrobiol. 43, suppl. I: 156.

H o r n e f M.W., M.J. W i c k, M. R h e n and S. N o r m a r k. 2002. Bacterial strategies for overcoming host innate and adaptiveimmune responses. Nature Immun. 3: 1033�1040.

K a c a W., E. L i t e r a c k a, G. S j o h o l m and A. W e i n t r a u b. 2000. Complement activation by Proteus mirabilis nega-tively charged lipopolysaccharides. J. Endotox. Res. 6: 223�234.

K o n d a k o v a A.N., R. F u d a ³ a, S.N. S e n c h e n k o v a, A.S. S h a s h k o v and W. K a c a. 2003. Structural and serolo-gical studies of the O-antigen of Proteus mirabilis O9. Carbohydr. Res. 338: 1191�1196.

L a e m m l i U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680�686.M e r i n o S., M.M. N o g u e r a s, A. A g u i l a r, X. R u b i r e, S. A l b e r t i, V.J. B e n e d i and J.M. T o m a s. 1998. Activa-

tion of the complement classical pathway (C1q Binding) by mesophilic Aeromonas hydrophila outer membrane protein.Infect Immun. 66: 3825�3831.

M i e l n i k G., A. G a m i a n and W. D o r o s z k i e w i c z. 2001. Bactericidal activity of normal cord serum (NCS) againstGram-negative rods with sialic acid-containing lipopolysaccharides (LPS). FEMS Immun. Med. Microbiol. 31: 169�173.

M u r p h y T. and L.C. B a r t o s. 1989. Surface-exposed and antigenically conserved determinants of outer membrane proteins ofBranhamella catarralis. Infect Immun. 10: 2938�2941.

M u r p h y T.F., A.L. B r a u e r, N. Yu s k i w and T.J. H i l t k e. 2000. Antigenic structure of outer membrane protein E ofMoraxella catarrhalis and construction and characterization of mutants. Infect Immun. 68: 6250�6256.

P i l z D., T. Vo c k e, J. H e e s e m a n n and V. B r a d e. 1992. Mechanism of YadA-mediated serum resistance of Yersiniaenterocolitica serotype O3. Infect Immun. 60: 189�195.

P r a s a d a r a o N.V., A.M. B l o m, B.O. V i l l o u t r e i x and L.C. L i n s a n g a n. 2002. A novel interaction of outer mem-brane protein A with C4b binding protein mediates serum resistance of Escherichia coli K1. J. Immun. 169: 6352�6360.

R o i t t I. and D. M a l e. 2000. Immunology (in Polish). Wydawnictwo Lekarskie PZWLR ó ¿ a l s k i A., Z. S i d o r c z y k and K. K o t e ³ k o. 1997. Potential virulence factors of Proteus bacilli. Microb. Molecul. Biol.

Rev. 61: 65�89.S i m R.B. and S.A. T s i f t s o g l o u. 2004. Proteases of the complement system. Biochem. Soc. Trans. 32: 21�27.V u k a j l o v i c h S.W., J.L. R y a n and C.D. M o r r i s o n. 1992. Interaction of LPS with serum complement, in bacterial endo-

toxic lipopolysaccharides. CRC Press II: 213�235.V u k a j l o v i c h S.W., J. H o f f m a n and C.D. M o r r i s o n. 1987. Activation of human serum complement by bacterial

lipopolysaccharides: structural requirements for antibody independent activation of classical and alternative pathways. Mol.Immun. 24: 319�331.

W e b e r G., D. H e c k, R.R. B a r t l e t t and K. N i x d o r f f. 1992. Modulation of effects of lipopolysaccharide on macrophagesby a major outer membrane protein of Proteus mirabilis as measured in a chemiluminescence assay. Infect Immun. 60: 1069�1075.

W h i t e C.D., I. L e d u c, B. O l s e n, C. J e t e r, C. H a r r i s and C. E l k i n s. 2005. Haemophilus ducreyi outer membranedeterminants, including DsrA, define two clonal populations. Infect. Immun. 73: 2387�2399.

Z i ó ³ k o w s k i A., A. S h a s h k o v, A.S. � w i e r z k o, S.N. S e n c h e n k o v a, F.V. T o u k a c h, M. C e d z y ñ s k i,K.I. A m a n o, W. K a c a and Y.A. K n i r e l. 1997. Structures of the O-antigen of Proteus bacilli belonging to IX group(serogroup O1-O3) used in Weil-Felix test. FEBS Letters 411: 221�224.


Lack of an Association between Helicobacter Infectionand Autoimmune Hepatitis in Children

KATARZYNA DZIER¯ANOWSKA-FANGRAT,1,2* INGRID NILSSON,3 MA£GORZATA WO�NIAK,4

PAULINA JÓ�WIAK,1 EL¯BIETA RO¯YNEK,1 MAREK WOYNAROWSKI,4 JERZY SOCHA,4

ÅSA LJUNGH3 and TORKEL WADSTRÖM3

1 Department of Clinical Microbiology and Immunology,4 Department of Gastroenterology, Children�s Memorial Health Institute, Warsaw, Poland

2 Department and Institute of Nursing Care, Rzeszów University, Poland3 Department of Medical Microbiology, Dermatology and Infection, Lund University, Sweden

Received 27 December 2005, revised 29 March 2006, accepted 31 March 2006

A b s t r a c t

An association between Helicobacter infection and autoimmune hepatitis (AIH) in children was investigated. The preva-lence of antibodies to H. pylori did not differ between the AIH and the control group, (22% versus 14%), and antibodiesto non-gastric Helicobacter were not detected in either group. H. pylori DNA was found in two AIH liver tissues, butHelicobacter was not cultured from any sample.

K e y w o r d s: autoimmune hepatitis, Helicobacter

In recent years a body of evidence suggesting a possible association between Helicobacter sp. infectionand hepatobiliary diseases has arisen from both animal and human studies. It has been shown that persistentHelicobacter hepaticus infection in mice can induce chronic active hepatitis with subsequent liver tumors(Ward et al., 1994). Genetic material of various Helicobacter species has been detected in bile, gallbladderand liver tissues from patients with cholecystitis (Fox et al., 1998), hepatocellular carcinoma (Nilsson et al.,2001), primary biliary cirrhosis (PBC) and primary sclerosing cholangitis (PSC) (Nilsson et al., 2000). Allthese findings have prompted us to investigate if there is any association between Helicobacter infectionand autoimmune hepatitis (AIH).

A total of 32 children (mean age 12.8 years; range 3�18 years; 20 females, 12 males) with autoimmunehepatitis presenting for control investigation including liver biopsy were included in the study. The auto-antibody profile was consistent with type I AIH in 30 children (antinuclear antibodies and/or smooth muscleantibodies), whereas the remaining two patients had type II AIH (antibodies to liver-kidney microsometype 1). From each child 2 ml of blood was taken for serology and a transcutaneous liver biopsy wasobtained for histology, culturing and PCR. The control group for the comparison of seroprevalence of anti-bodies to H. pylori and non-gastric Helicobacter species consisted of 44 healthy children (mean age10.3 years; range 1�18 years, 20 females, 24 males) presenting either for a routine vaccination or otherwisehealthy children treated in the Department of Orthopedic Surgery.

The study was undertaken with the approval of the Ethics Committee of Children�s Memorial HealthInstitute, and informed consent was obtained from all participants.

Antibodies to Helicobacter pylori and non-gastric Helicobacter species (i.e. H. pullorum, H. bilis,H. hepaticus), were detected using immunoblot assay, as described previously (Nilsson et al., 1997;Kornilovs�ka et al., 2002). Cultures of liver samples were performed on Wilkins Chalgren agar with 7%horse blood and Dent�s selective supplement SR 147 (Oxoid) under microaerophilic conditions at 37°C for

* Corresponding author: Katarzyna Dzierzanowska-Fangrat, Department of Clinical Microbiology and Immunology, Children�sMemorial Health Institute, Aleja Dzieci Polskich 20, 04-730 Warsaw, Poland; tel.: (+48) 228157168; fax: (+48) 228157159; e-mailaddress: [email protected]

158 Dzier¿anowska-Fangrat K. et al. 2

up to 21 days. All liver samples from AIH patients were analysed by PCR to detect Helicobacter sp. DNA.The DNA was extracted by use of QIAamp DNA Mini kit (Qiagen). The purified DNA was subjected totwo separated PCRs with Helicobacter genus-specific primers (Fox et al., 1998) generating 16S rRNAamplicons of 1200 or 400 bp. Amplified DNA fragments were separated by electrophoresis on 2% agarosegel, stained with ethidium bromide and visualized under UV light. The 400 bp PCR products were purifiedusing PCR-purification kit (Qiagen) and subjected to direct sequencing of both strands with an automatedDNA sequencer (ABI PRISM 310).

The prevalence of antibodies to Helicobacter in AIH patients and controls was compared using thechi-squared test. The prevalence of antibodies to H. pylori and non-gastric Helicobacter species did notdiffer significantly between AIH children and control subjects. Antibodies to H. pylori were found in 7 of32 (22%) AIH patients compared with 6 of 44 (14%) controls. Antibodies against non-gastric Helicobacterspecies were not detected in any patient from either group. Helicobacter DNA was found in the liver samplesfrom two children with AIH (6%). The sequencing analysis revealed that both sequences closely resembledH. pylori, with the similarity rates exceeding 99.7%. The two patients whose liver samples contained H. pyloriDNA were also anti-H. pylori positive. None of the liver cultures showed the presence of Helicobacter species.

The present study revealed that the seroprevalence of antibodies to H. pylori did not differ significantlybetween children with AIH and a control group. This finding is consistent with previous observations,indicating that the frequencies of antibodies to H. pylori in adult AIH patients were similar to those incontrols (Durazzo et al., 2002; Nilsson et al., 2003). On the other hand, AIH and PSC adult patients werereported to have a higher prevalence of anti-H. pullorum, anti-H. bilis and anti-H. hepaticus antibodies ascompared to blood donors (Nilsson et al., 2003), which is in conflict with the present results, where no suchantibodies were detected in either AIH or control subjects. Since both, the former (Nilsson et al., 2003)and the present, serological studies have been performed in the same laboratory (Department of MedicalMicrobiology, Lund University) using the same methods, this discrepancy cannot be attributed to methodo-logical differences. It could, however, be related to regional variability and differences in patient popula-tions. The Polish children participating in the study were much younger than the Swedish patients, whichcould influence the exposure to Helicobacter species.

Helicobacter DNA was found in only two AIH liver tissues, and both sequences showed high similarityto H. pylori. This finding is in line with the serological results, since both patients were also anti-H. pyloripositive and did not have antibodies to other Helicobacter species tested. However, despite prolonged incu-bation, we were not able to culture Helicobacter sp. from any of tested samples. Similarly, with one excep-tion (Queiroz et al., 2001), all other attempts to cultivate Helicobacter sp. from human hepatobiliary materi-als have been unsuccessful, in spite of the presence of their genetic material (Fox et al., 1998; Avenaudet al., 2000; Silva et al., 2003). The inability to cultivate Helicobacter in some of the former studies wassuggested to be attributed to the fact that long-stored frozen samples have been used for culturing (Foxet al., 1998; Silva et al., 2003). In our study, however, all the samples were cultured directly after collection,and therefore sample processing was unlikely to influence the results. Detection of H. pylori DNA, but notculturable cells in the liver tissues of AIH patients could therefore indicate that the bacteria were eithernonviable or that they were present in very low numbers or in a non-culturable coccoid form. The fact thatHelicobacter genetic material was found only in two AIH liver samples and the seroprevalence of anti-Helicobacter antibodies did not differ between the AIH and the control group suggests that these bacteriaare unlikely to be associated with the pathogenesis of autoimmune hepatitis in children.

Acknowledgements. This study was supported by grants from the Polish Committee for ScientificResearch (PB 069 PO5 2001 21), Swedish Research Council (16x04723 and 6x11229), the UniversityHospital of Lund (ALF) and the Forssman Foundation of the Royal Physiographic Society in Lund.

Literature

A v e n a u d P., A. M a r a i s, L. M o n t e i r o, B. L e B a i l, P. B i o u l a c S a g e, C. B a l a b a u d and F. M e g r a u d. 2000.Detection of Helicobacter species in the liver of patients with and without primary liver carcinoma. Cancer 89: 1431�1439.

D u r a z z o M., R. P e l l i c a n o, A. P r e m o l i, M. B e r r u t t i, N. L e o n e, A. P o n z e t t o and M. R i z z e t t o. 2002.Helicobacter pylori seroprevalence in patients with autoimmune hepatitis. Dig. Dis. Sci. 47: 380�383.

F o x J.G., F.E. D e w h i r s t, Z. S h e n, Y. F e n g, N. S. T a y l o r, B.J. P a s t e r, R.L. E r i c s o n, C.N. L a u, P. C o r r e a,J.C. A r a y a and I. R o a. 1998. Hepatic Helicobacter species identified in bile and gallbladder tissue from Chileans withchronic cholecystitis. Gastroenterology 114: 755�763.

159Short communication2

K o r n i l o v s � k a I., I. N i l s s o n, M. U t t, A. L j u n g h and T. W a d s t r o m. 2002. Immunogenic proteins of Helicobacterpullorum, Helicobacter bilis and Helicobacter hepaticus identified by two-dimensional gel electrophoresis and immuno-bloting. Proteomics 2: 775�783.

N i l s s o n I., A. L j u n g h, P. A l e l j u n g and T. W a d s t r o m. 1997. Immunoblot assay for serodiagnosis of Helicobacterpylori infections. J. Clin. Microbiol. 35: 427�432

N i l s s o n H.-O., J. T a n e e r a, M. C a s t e d a l, E. G l a t z, R. O l s s o n and T. W a d s t r o m. 2000. Identification of Helico-bacter pylori and other Helicobacter species by PCR, hybridization, and partial DNA sequencing in human liver samplesfrom patients with primary sclerosing cholangitis or primary biliary cirrhosis. J. Clin. Microbiol. 39: 1072�1076.

N i l s s o n H.-O., R. M u l c h a n d a n i, K.G. T r a n b e r g, U. S t e n r a m and T. W a d s t r o m. 2001. Helicobacter speciesidentified in liver from patients with cholangiocarcinoma and hepatocellular carcinoma. Gastroenterology 120: 323�324.

N i l s s o n I., I. K o r n i l o v s � k a, S. L i n d g r e n, A. L j u n g h and T. W a d s t r o m. 2003. Increased prevalence of sero-positivity for non-gastric Helicobacter species in patients with autoimmune liver disease. J. Med. Microbiol. 52: 949�953.

Q u e i r o z D.M.M., A. S a n t o s, A.G. O l i v e i r a, G.A. R o c h a, S.B. M o u r a, E.R.S. C a m a r g o, P.R. Va l l e,L.A.F. B i c a l h o and R. D a n i. 2001. Isolation of a Helicobacter strain from the human liver. Gastroenterology 121:1023�1024.

S i l v a C.P., J.C. P e r e i r a - L i m a, A.G. O l i v e i r a, J.B. G u e r r a, D.L. M a r q u e s, L. S a r m a n h o, M.M.D.A. C a b r a land D.M.M. Q u e i r o z. 2003. Association of the presence of Helicobacter in gallbladder tissue with cholelithiasis andcholecystitis. J. Clin. Microbiol. 41: 5615�5618.

Wa r d J.M., J.G. F o x, M.R. A n v e r, D.C. H a i n e s, C.V. G e o r g e, M.J.Jr. C o l l i n s, P.L. G o r e l i c k, K. N a g a s h i m a,M.A. G o n d a, R.V. G i l d e n, J.G. T u l l y, R.J. R u s s e l, R.E. B e n v e n i s t e, B.J. P a s t e r, F.E. D e w h i r s t,J.C. D o n o v a n, L.M. A n d e r s o n and J.M. R i c e. 1994. Chronic active hepatitis and associated liver tumors in micecaused by a persistent bacterial infection with a novel Helicobacter species. J. Natl. Cancer. Inst. 86: 1222�1227.

160 Dzier¿anowska-Fangrat K. et al. 2

Polish Journal of Microbiologyformerly Acta Microbiologica Polonica

2006, Vol. 55, No 2

Instructions to authors

I. General information

Polish Journal of Microbiology publishes descriptions of all aspects of basic and applied research thatfocuses on topics of basic research of practical value in microbiology. Topics that are considered includemicrobiology of a genetic and molecular nature, foods, agriculture, industry, biotechnology, microbial eco-logy, public health and basic biological properties of bacteria, viruses, and simple eukaryotic microorganisms.

Submit manuscripts directly to the Editorial Office, Polish Journal of Microbiology. The manuscriptshould be accompanied by a covering letter stating the address, fax number, e-mail of the correspondingauthor and �running head� of the manuscript (no longer than 47 characters). Submit two complete copies ofeach manuscript, including figures and tables. The manuscript should be either the original typescript fromjet or laser printer (not dot matrix).

Accepted papers are copy-edited as word-processor files, so authors are asked to provide their paperin this form on a disk when they submit the revised version. The text should be edited in Word 7 or higher orASCII. Submission of figures in TIF or CorelDraw Format is appreciated.

All manuscripts are subjected to peer review by the editors, by members of the editorial board and byqualified outside reviewers. When a manuscript is returned to the authors for modification, it shouldbe returned to the editor within 2 months; otherwise it may be considered withdrawn.

15 reprints are sent free to the first author.

II. Preparation of the manuscript

The original paper should be divided into the following sections written in sequence: Abstract,Introduction, Experimental: Materials and Methods and Results, Discussion, Acknowledgments, Literature.Type every portion of the manuscript double spaced with left hand margins, including figure legends, tables,table footnotes, and literature cited (type Literature sections on separate pages), and number all pages insequence, including the abstract, tables and figure legends. The literature section must include all citedwork. Arrange the citations in alphabetical order by first authors. Key words (no more than five) and thesuggestion of runing head should be included.

A paper in the form of a short communication must have an abstract of no more than 100 words. Do notuse section headings in the body of the �Communication�; report introduction, methods, results, and discus-sion in a single section. The text should be concise, and the number of figures and tables should be kept toa minimum. Material and methods should be described in the text, not in figure legends or table footnotes.Present acknowledgments as in full-length papers.

Minireviews are published in areas of particular interest and importance. They are usually invited, butauthors wishing to submit a minireview should contact the scientific editor for further information.

Before writing a manuscript authors are advised to consult a current issue of Polish Journal of Microbio-logy and carefully read the detailed �Instruction to authors� printed in number 1 of every volume in order tobe familiar with the literature citations, preparation of figures and tables and the rules concerning chemical,biochemical, genetic etc. nomenclature recommended.

Polish Journal of Microbiology, formerly Acta Microbiologica Polonica, is a broad-based microbiologicaljournal covering: General Microbiology, Bacterial Physiology and Genetics, Virology, Clinical Bacterio-logy, Environmental Microbiology and Biotechnology.

Polish Journal of Microbiology publishes mainly original research articles including short communicationsbut also minireviews, book reviews and press releases. All the papers should be prepared following�Instructions to Authors� which is always included in the first issue of every year. The papers appear usuallywithin 3 months after final acceptance.

Polish Journal of Microbiology is currently indexed by: BIOSIS/Biological Abstracts, EMBASE/ExcerptaMedica, Index Medicus/MEDLINE, Cambridge Scientific Abstracts (series: Biological Sciences, Micro-biology A, B, C), SCOPUS, Index Copernicus.

Submission of manuscripts in various areas of Microbiology is very welcome.

Advertising offer

The editorial office of the Polish Journal of Microbiology encourages our Readers to place advertisementsin our quarterly. Polish Journal of Microbiology reaches scientists working in various research institutionsand Universities and involved in different areas of microbiology, such as General Microbiology, MolecularMicrobiology, Clinical Microbiology, Environmental Microbiology, Biotechnology. We ensure rapid ap-pearance of the ad.

Price of black and white ad on inside cover:half page = 150 PLNfull page = 300 PLN

Price of ad inside an issuehalf page = 75 PLNfull page = 150 PLN

Please send file with graphical layout to the editorial office of the Polish Journal of Microbiology,02-096 Warsaw, Miecznikowa 1, phone 48 (22) 55 41 302

Do cz³onkówPolskiego Towarzystwa Mikrobiologów

Zarz¹d P.T.M. uprzejmie prosi wszystkich cz³onków o wp³atê zaleg³ych i bie¿¹cych sk³adek cz³onkowskich.Zachêcamy tak¿e do zaprenumerowania �Polish Journal of Microbiology�.

Polish Journal of Microbiology · \pjm\ at PTM Journals online Visit the home page to browse...

Documents

Transcript of Polish Journal of Microbiology · \pjm\ at PTM Journals online Visit the home page to browse...